Article Figures & Data
Figures
- FIG 1
Neighbor-joining tree showing the genetic relatedness of 74 clinical K. oxytoca isolates combined with clinical and phenotypic information. Stool isolates are indicated by green squares and respiratory isolates by orange squares, shown to the right of the isolate number. Bootstrap values, denoting the reliability of the given branches, are shown next to the tree nodes. Only values of >60% are shown. Clusters/subclusters are indicated in large letters on the tree. All the isolates were resistant to ampicillin. The scale bar represents 0.01 substitutions per site. CC, clonal complex; r.t., respiratory tract; u.t., urinary tract; AAHC, antibiotic-associated hemorrhagic colitis; COPD, chronic obstructive pulmonary disease; CSSTI, complicated skin and skin structure infection; DFS, diabetic foot syndrome; IBD, inflammatory bowel disease; UTI, urinary tract infection; VAP, ventilator-associated pneumonia; AUT, Austria; ESP, Spain; GER, Germany; HKG, Hong Kong; JPN, Japan; NED, Netherlands; ESBL, extended spectrum β-lactamase; CRE, carbapenem-resistant Enterobacteriaceae; N, nosocomial; O, outpatient; n/a, information not available.
- FIG 2
Clonal diversity of K. oxytoca isolates. eBURST (22) was used to calculate clonal complexes (CC) that contain single-locus variants (SLVs) that share 6 of 7 MLST alleles (STs connected by lines). The single-locus difference between SLVs is indicated by the gene name next to the connecting line. The relative positions and spacing between the STs are not related to genetic distance. Each ST is represented by a dot, the size of which varies directly with the frequency of the ST in the population.
- FIG 3
Split decomposition analysis for K. oxytoca strains. SplitsTree (23) was used for analysis of concatenated sequences of the seven MLST loci. Each K. oxytoca ST (included in Fig. 1), regardless of frequency within the population, was included once in the analysis.
Tables
- TABLE 1
Clinical and phenotypical attributes of K. oxytoca isolatesa
Isolation site Diagnosisb N and/or Oc Toxind Country of isolatione Stool (40) AAHC (16), diarrhea/colitis of other causes (11), IBD (3), asymptomatic carrier (7), follow-up/AAHC (1), asymptomatic carrier/UTI (1), NA (1) N (9), O (25), NA (6) Positive (31), Negative (9) JPN (1), USA (1), NED (2), AUT (30), ESP (1), HKG (3), GER (2) Respiratory tract (21) Nosocomial pneumonia/VAP (13), COPD (2), cystic fibrosis (1), pneumonia (2), pharyngitis (2), pneumothorax (1) N (15), O (6) Positive (3), Negative (18) AUT (21) Urinary tract (4) UTI (4) N (2), O (2) Negative (4) AUT (4) Blood (2) AAHC with bacteremia (1), bacteremia (1) O (2) Positive (1), Negative (1) AUT (2) Skin/mucous membranes (7) DFS (4), CSSTI (2), oral abscess (1) O (7) Positive (4), Negative (3) AUT (7) ↵a The number of isolates within a given category is shown in parentheses.
↵b AAHC, antibiotic-associated hemorrhagic colitis; IBD, inflammatory bowel disease; UTI, urinary tract infection; VAP, ventilator-associated pneumonia; COPD, chronic obstructive pulmonary disease; DFS, diabetic foot syndrome; CSSTI, complicated skin and skin structure infection.
↵c Isolates were classified as nosocomial (N) when infection occurred 48 h after hospitalization. O, outpatient; NA, information not available.
↵d Cytotoxicity was assessed via an MTT-based cell culture assay (6).
↵e JPN, Japan; NED, Netherlands; AUT, Austria; ESP, Spain; HKG, Hong Kong; GER, Germany.
- TABLE 2
Nucleotide polymorphisms among K. oxytoca isolates and MLST target and PCR primer information
Gene Putative gene function Oligonucleotide Oligonucleotide sequence (5′ to 3′)a Size of analyzed fragment (bp) No. of allelesb No. of polymorphic sitesb Mean % G+C content Variation indicesb πc dN/dSd gapA Glyceraldehyde-3-phosphate dehydrogenase gapA_fwd GTTTTCCCAGTCACGACGTTGTATGAAGTATGACTCCACTCACGG 450 8 (9) 15 (16) 53.7 0.01340 (0.01335) 0.000 (0.000) gapA_rev TTGTGAGCGGATAACAATTTCAACGCCTTTCATTGCGCCTTCGGAA infB Translation initiation factor 2 infB_fwd GTTTTCCCAGTCACGACGTTGTACTCTCTGCTGGACTACATTCG 318 15 (17) 48 (50) 59.2 0.05615 (0.05625) 0.139 (0.137) infB_rev TTGTGAGCGGATAACAATTTCCGCTTTCAGCTCCAGAACTTC mdh Malate dehydrogenase mdh_fwd GTTTTCCCAGTCACGACGTTGTACCCAACTGCCTTCAGGTTCAG 477 25 (25) 86 (86) 52.1 0.05222 (0.05233) 0.032 (0.031) mdh_rev TTGTGAGCGGATAACAATTTCCCTTCCACGTAGGCGCATTCC pgi Phosphoglucose isomerase pgi_fwd GTTTTCCCAGTCACGACGTTGTAGAGAAAAACCTGCCGGTGCTGCTG 432 27 (29) 45 (45) 56.2 0.03008 (0.03023) 0.008(0.008) pgi_rev TTGTGAGCGGATAACAATTTCCGGTTAATCAGGCCGTTAGTGGAGC phoE Phosphoporine E phoE_fwd GTTTTCCCAGTCACGACGTTGTAACCTGGCGCAACACCGATTTCTTC 420 26 (28) 52 (54) 53.7 0.03315 (0.03337) 0.020 (0.019) phoE_rev TTGTGAGCGGATAACAATTTCTTCAGCTGGTTGATTTTGTAATCCAC rpoB RNA polymerase subunit β rpoB_fwd GTTTTCCCAGTCACGACGTTGTAGGCGAAATGGCGGAAAACCA 501 19 (21) 40 (42) 54.3 0.01777 (0.01812) 0.001 (0.001) rpoB_rev TTGTGAGCGGATAACAATTTCGAGTCTTCGAAGTTGTAACC tonB Periplasmic energy transducer tonB_fwd GTTTTCCCAGTCACGACGTTGTACTCTATACTTCGGTACATCAGGTT 405 25 (27) 78 (79) 61.9 0.05920 (0.06001) 0.092 (0.095) tonB_rev TTGTGAGCGGATAACAATTTCCCTGTTTGGCGGCCAGCACCTGGT Concatenated sequence 3,003 55.6 0.03607 (0.03631) ↵a Specific oligonucleotides: bold-type sequence binds target gene, underlined sequence (overhang) serves as annealing site for sequencing primer (phoE was sequenced with distinct nested primers).
↵b Publicly available K. oxytoca NCBI sequence data were combined with the Sanger sequences from clinical isolates to generate a separate alignment which yielded the values given in brackets.
↵c Diversity index (π) is equal to the average number of nucleotide differences per site.
↵d dN/dS, ratio of nonsynonymous to synonymous substitutions.
- TABLE 3
Primers used for Sanger sequencing in this study
Primer name Sequence (5′ to 3′) MLST_seq_fwd GTTTTCCCAGTCACGACGTTGTA MLST_seq_rev TTGTGAGCGGATAACAATTTC phoE_seq_fwd TTTCTTCGGCGTGGTAGATCC phoE_seq_rev GTAATCCACAAAGGCATTC - TABLE 4
Clinical, genetic, and phenotypic information of sequence types represented by more than one K. oxytoca isolate
Sequence type Isolate Toxina Geographic originb Isolation site Diagnosisc Isolation date (mo/yr) Antibiotic resistance typed Nosocomial (N)/outpatient (O)e Clonal complex Cluster 1 34 + AUT (Graz) Stool AAHC 3/2004 O A 1 45 + AUT (Graz) Stool Follow-up/AAHC 4/2004 O A 2 56 + AUT (Graz) Stool AAHC 4/2004 O 2 A 2 379 + ESP Stool/rectal swab NA 5/2009 CRE N 2 A 4 33 − AUT (Styria) Skin CSSTI 5/2004 O 8 A 4 73 − AUT (Graz) Stool Asymptomatic carrier 4/2004 ESBL N 8 A 4 81 + AUT (Graz) Stool Asymptomatic carrier 6/2005 O 8 A 4 204 + AUT (Graz) Stool AAHC 8/2008 ESBL O 8 A 4 231 − AUT (Graz) Respiratory tract Nosocomial pneumonia 10/2010 ESBL + CRE N 8 A 4 402 − AUT (Graz) Respiratory tract Pneumonia 6/2013 O 8 A 9 37 + AUT (Graz) Stool Asymptomatic carrier 4/2004 ESBL N A 9 128 + AUT (Styria) Stool IBD 3/2007 O A 9 188 + AUT (Vienna) Stool AAHC 1/2008 NA A 9 222 + AUT (Graz) Stool AAHC 11/2009 ESBL O A 9 232 + AUT (Graz) Blood AAHC with bacteremia 8/2010 O A 9 382 + AUT (Graz) Stool IBD 8/2013 O A 9 425 + GER Stool Diarrhea 2013 O A 11 75 − AUT (Graz) skin DFS 4/2004 O 4 B1 11 400 − AUT (Graz) Respiratory tract VAP 6/2013 N 4 B1 18 113 − AUT (Burgenland) Stool Asymptomatic carrier 6/2005 O 2 A 18 336 + HKG Stool Diarrhea NA NA 2 A 33 180 − AUT (Graz) Stool AAHC 12/2007 O 1 A 33 227 + AUT (Vienna) Stool AAHC 6/2010 O 1 A 36 195 + AUT (Graz) Stool UTI 1/2008 N A 36 195-H − AUT (Graz) Urinary tract UTI 1/2008 N A 38 131 − AUT (Styria) Stool Asymptomatic carrier 4/2007 O B2 38 333 + AUT (Salzburg) Stool Colitis 3/2014 O B2 40 21 − AUT (Graz) Respiratory tract VAP 11/2003 N B1 40 284 − AUT (Graz) Respiratory tract Nosocomial pneumonia 2/2012 N B1 41 23 − AUT (Graz) Respiratory tract VAP 11/2003 N 3 B1 41 389 − AUT (Graz) Respiratory tract Pneumothorax 9/2013 O 3 B1 44 40 − AUT (Graz) Respiratory tract VAP 5/2004 ESBL N B1 44 179 − AUT (Styria) Urinary tract UTI 11/2007 ESBL O B1 ↵a Cytotoxicity was assessed via an MTT-based cell culture assay (6).
↵b AUT, Austria; ESP, Spain; GER, Germany; HKG, Hong Kong.
↵c AAHC, antibiotic-associated hemorrhagic colitis; NA, information not available; CSSTI, complicated skin and skin structure infection; IBD, inflammatory bowel disease; DFS, diabetic foot syndrome; VAP, ventilator-associated pneumonia; UTI, urinary tract infection.
↵d All isolates were resistant to ampicillin. ESBL, extended spectrum β-lactamase; CRE, carbapenem-resistant Enterobacteriaceae.
↵e Isolates were classified as nosocomial when infection occurred after 48 h of hospitalization.
Supplemental material
Files in this Data Supplement:
- Supplemental file 1 -
Fig. S1 (Neighbor-joining tree showing the genetic relatedness of 54 clinical K. oxytoca isolates, including 7 isolates with published sequences), S2 (Similar phylogenetic clustering of K. oxytoca isolates is obtained based on concatenated MLST target sequences and results of whole-genome BLAST search results), and S3 (Neighbor-joining trees based on the individual genetic loci of the K. oxytoca MLST scheme) and Table S1 (Summary of genetic, typing, and clinical information for K. oxytoca isolates included in this study)
PDF, 1.6M
- Supplemental file 1 -
