ABSTRACT
Mycoplasma hyorhinis has been implicated in a variety of swine diseases. However, little is known about the hemolytic capabilities of Mycoplasma species in general or M. hyorhinis in particular. In this study, we show that M. hyorhinis possesses beta-hemolytic activity which may be involved in the invasion process. M. hyorhinis also possesses antagonistic cooperativity (reverse CAMP phenomenon) with Staphylococcus aureus beta-hemolysis, resulting in the protection of erythrocytes from the beta-hemolytic activity of S. aureus (reverse CAMP). The reversed CAMP phenomenon has been attributed to phospholipase D (PLD) activity. In silico analysis of the M. hyorhinis genome revealed the absence of the pld gene but the presence of the cls gene encoding cardiolipin synthetase, which contains two PLD active domains. The transformation of Mycoplasma gallisepticum that has neither the cls gene nor the reverse CAMP phenomenon with the cls gene from M. hyorhinis resulted in the reverse CAMP phenomenon, suggesting for the first time that reverse CAMP can be induced by cardiolipin synthetase.
INTRODUCTION
Mycoplasmas (class Mollicutes) are the smallest self-replicating bacteria. These bacteria form a large group of prokaryotic microorganisms with over 200 species, distinguished from ordinary bacteria by their small size, minute genome, and total lack of cell walls (1). Most mycoplasmas are parasites and depend on host adhesion for infection (2, 3). Numerous pathogenic Mycoplasma species possess hemadsorption and cytadherence activities, such as hydrogen peroxide-mediated and membrane-associated hemolytic activities, which are associated with virulence potential (4, 5). Bacterial hemolysins can lyse red blood cells (RBCs) and a variety of other cell types, such as mast cells, neutrophils, and polymorphonuclear cells (6). Hemolysins enable hemolytic microorganisms to directly damage host tissues as well as induce inflammatory responses (5, 7, 8). Many hemolysins, such as the oxygen-labile hemolysins (e.g., streptolysin O, pneumolysin O, perfringolysin O, and listeriolysin O) are cholesterol dependent and require the presence of a reducing agent, such as cysteine, in order to obtain hemolytic activity (9).
Another factor, known as the CAMP factor, first described by Christie et al. (10), has been used for microbiological identification of Streptococcus agalactiae (group B streptococci [GBS]) since it characteristically synergizes with the secreted β-hemolysin of S. aureus to lyse erythrocytes on blood agar plates (11). In Clostridium perfringens (12) and Corynebacterium pseudotuberculosis (13, 14), however, the rare antagonistic interaction (reverse CAMP phenomenon) was described where the beta-hemolysis of staphylococci was inhibited, apparently through the activity of a phospholipase D (PLD) (14).
Mycoplasma hyorhinis was first isolated from the respiratory tract of young pigs and has been implicated in a variety of diseases in swine (15, 16). M. hyorhinis is also one of the most common Mycoplasma species that contaminate various cell lines (17). Recently, we demonstrated that an M. hyorhinis (strain MCLD) invades nonphagocytic eukaryotic cells (18). This organism possesses a phospholipase A involved in the plasma membrane disruption, but not phospholipase C or PLD activities (19).
In the present study, we showed that M. hyorhinis possesses unique cholesterol-independent heat- and protease-stable β-hemolysin activity. Interestingly, we found that M. hyorhinis displays the rare reverse CAMP phenomenon, resulting in the protection of RBCs from the beta-hemolytic activity of S. aureus. Our results show for the first time that cardiolipin synthetase (CLS) of M. hyorhinis, which contains the two PLD-conserved motifs, induces the reverse CAMP reaction.
MATERIALS AND METHODS
Organisms and growth conditions.M. hyorhinis (MCLD), Mycoplasma gallisepticum (Rlow), M. fermentans (JER), M. mycoides (PG1), M. pneumoniae (M129), M. capricolum (California kid), M. penetrans (GTU), and M. hominis (PG21) were from our strain collection. The organisms were grown for 48 to 72 h at 37°C in a modified Hayflick medium (20) containing either 10% fetal calf serum or 5% horse serum. Mycoplasmal growth was monitored by measuring the absorbance at 595 nm and by recording pH changes in the growth medium. The organisms were collected by centrifugation at 12,000 × g for 20 min, washed twice, and resuspended in a cold solution of Tris-HCl 10 mM and NaCl 250 mM (TN buffer) (pH 7.5). Total protein was determined and adjusted to a concentration of 1 mg · ml−1. Staphylococcus aureus and Listeria monocytogenes were obtained from the strain collection of the Department of Clinical Microbiology and Infectious Diseases, Hadassah Medical Center, Jerusalem, Israel, and grown on 5% sheep blood Trypticase soy agar (TSA) plates (Novamed, Jerusalem, Israel).
Preparation of mycoplasmal fractions.Mycoplasma membrane and cytosolic preparations were obtained by ultrasonic treatment of washed intact cells as described previously (19). Membranes were separated from the supernatant fraction by centrifugation in the cold at 37,000 × g for 30 min. To obtain the cytosolic fraction, the supernatant was further centrifuged at 100,000 × g for 2 h to remove membrane fragments and ribosomes. The cytosolic fraction was kept at −70°C until used.
Hemolytic activity of M. hyorhinis.Qualitative hemolysis was determined by plating intact M. hyorhinis cells harvested at the stationary phase of growth (5 μl of 1 mg · ml−1 cell protein) on 5% sheep blood TSA plates (Novamed, Jerusalem, Israel) and incubated at 37°C. After 2 to 3 days, the plates were examined for hemolysis. Quantitate hemolysis was determined spectrophotometrically using sheep blood samples (Novamed, Jerusalem, Israel), pig blood samples (Lahav CRO, Israel), or chicken blood samples (from specific-pathogen-free [SPF] White Leghorn chickens). The blood samples were washed twice in phosphate-buffered saline (PBS) and diluted to a final concentration of 2% packed cells. Hemolytic activity was determined as described before (4). In brief, 50 μg protein of intact M. hyorhinis cells, purified membranes or the cytosolic fraction, were incubated with 2% packed RBCs in a total volume of 1 ml (to be referred to as the test mixture), in the presence or absence of 2 to 4 mM cysteine (Merck) for 18 h at 37°C in a rotator shaker (30 rpm). To detect RBC lysis, the test mixture was centrifuged at 1,500 × g for 10 min, and measurement of the released hemoglobin was spectrophotometrically determined at 540 nm. Cooperative hemolysis (CAMP or reversed CAMP phenomena) was carried out as described before (10) with the following modifications. Twenty microliters of intact mycoplasma cells (5 mg · ml−1 cell protein) were inoculated onto sheep blood agar plates by making a streak down the center of each plate. The plates were incubated at 37°C for 48 to 72 h until beta-hemolysis was clearly seen. S. aureus was then streaked with a loop perpendicular to the mycoplasmas being tested. CAMP activity was assessed as the enlargement of the hemolytic zones (positive CAMP) after reincubation of the plates at 37°C for 48 h, as the inhibition of the hemolytic zone (reverse CAMP) after reincubation of the plates at 37°C for 48 to 72 h, or as the failure of bacteria to exhibit enhanced hemolysis when grown near colonies of the beta-hemolytic S. aureus (negative CAMP). M. gallisepticum transformants were grown at 37°C and then heat shocked at 42°C for 3 h before the CAMP test was carried out.
Cloning of cls from M. hyorhinis.The cls gene (SRH_00920) was cloned from M. hyorhinis genomic DNA with a commercial PCR kit (HotMasterMix kit; 5 PRIME, Inc., Gaithersburg, MD) with the forward primer Mh_cls_F (ATATGCGGCCGCAAGCAAATGAAAAATAAAAGAAGAGAAA), which includes a NotI restriction site (underlined), and the reverse primer Mh_cls_R (TATAGGCCAGCAAGGCCGTTTTCCTTTCAAAGCGTAAGCAA), which includes an SfiI restriction site (underlined). The single 1.56-kbp PCR product containing the cls gene was purified with a commercial PCR kit product (Wizard SV gel and PCR cleanup system; Promega, Madison WI) and verified by sequencing.
Construction of the pMT85:cls plasmid.The purified cls PCR product was inserted into the plasmid pMT85 (5.60 kbp) (50) containing the mini-Tn4001 transposon, a DNA fragment coding for the TAP-tag, the expression unit of the heat shock-inducible gene mpn531 (clpB) from M. pneumoniae, and an aminoglycoside antibiotic resistance determinant as a selectable marker, which confers resistance to kanamycin on Escherichia coli and to gentamicin on mycoplasmas. Both the plasmid and the purified cls PCR product were doubly digested by NotI and SfiI (New England BioLabs, Ipswich, MA) and ligated with T4 DNA ligase (New England BioLabs, Ipswich, MA) yielding the plasmid pMT85:cls (7.18 kbp).
Transformation of competent E. coli DH5α and plasmid purification.Plasmids were purified from E. coli DH5α with the plasmid DNA extraction kit (iNtRON Biotechnology, Gyeonggi-do, South Korea) and doubly digested by NotI and SfiI. The excised inserts were amplified by PCR and verified on a 1% agarose gel. The identity of the insert was confirmed by sequencing the plasmid with primers from both ends of the cls gene, pMT-cls_Nter_F (ATTGTCCTTGTTGTGAAGGT) and pMT-cls_Nter_R (CGCGTCTGGCCTTCCTGTAGC) for the N-terminal end and pMT-cls_Cter_F (ACTTTCGGCGCCTGAGCATC) and pMT-cls_Cter_R (GCCAAAGAGCTTCAAAACGAAGGAGC) for the C-terminal end.
Transformation of M. gallisepticum.Transformation of M. gallisepticum with the pMT85:cls was done by electroporation (21). After electroporation, the bacteria were allowed to recover in an antibiotic-free Hayflick medium and then diluted in tissue culture tubes with a medium containing gentamicin (80 μg · ml−1) and incubated at 37°C until the medium changed color from red to orange. The grown bacteria were centrifuged at 12,000 × g for 10 min, washed twice in TN buffer, diluted, and plated on agar plates containing gentamicin (80 μg · ml−1). Colonies were excised from the agar plate, transferred to tubes with Hayflick medium containing gentamicin (80 μg · ml−1), and incubated at 37°C until the medium changed color from red to orange. The successful transformation of M. gallisepticum was evaluated and confirmed by PCR with the pMT85:cls sequencing primers.
Gene expression analysis.Reverse transcription-quantitative PCR (RT-qPCR) was used to analyze the transcription levels of the cls gene in M. hyorhinis and M. gallisepticum transformants. RNA was purified from bacteria in mid-log growth using the PureLink RNA Minikit (Ambion). One microgram of RNA was reverse transcribed to cDNA with the use of a high-capacity reverse transcription kit (Applied Biosystems). RT-qPCR was performed on 10 ng of cDNA using SYBER green with the StepOnePlus RT-PCR system (Applied Biosystems). The relative expression of bacterial genes was determined by comparing their transcript levels with those of the bacterial 16S rRNA as a reference gene.
Analytical methods.Protein concentrations were analyzed by use of the Bradford method (22). Genomic DNA from M. hyorhinis was extracted and purified with the MasterPure Gram-positive DNA purification kit (Epicentre Biotechnologies, Chicago, IL). Thermal treatment of intact M. hyorhinis was achieved by boiling for 10 min. Proteolysis of intact M. hyorhinis was achieved by incubation with proteinase K (5 μg · ml−1) or trypsin (20 μg · ml−1) for 30 min at 37°C.
RESULTS
Beta-hemolytic activity of M. hyorhinis.Incubation of M. hyorhinis (equivalent to 5 μg) on 5% sheep blood TSA plates for 48 to 72 h at 37°C revealed a clear zone of hemolysis surrounding the mycoplasma colonies, indicating beta-hemolysis activity (Fig. 1A). Fractionation of M. hyorhinis revealed that the membrane fraction possesses hemolytic activity while the cytosolic fraction does not (Fig. 1A). When the hemolytic activity of M. hyorhinis was monitored spectrophotometrically, both intact M. hyorhinis cells (Fig. 1B) and purified membranes (Fig. 1C) incubated with 2% packed RBCs (18 h at 37°C) hemolyzed RBCs from sheep, chicken, and pig in a cysteine-dependent manner (2 to 4 mM). The hemolytic activity was not affected by glutathione (20 mM) but was completely inhibited by N-ethylmaleimide (4 mM, data not shown), suggesting that a sulfhydryl group is essential for the activity of the M. hyorhinis hemolysin.
The hemolytic activity of M. hyorhinis. (A) M. hyorhinis intact cells or purified membranes induced beta-hemolysis of sheep blood. Either cells, membranes, or cytosol (5 μg) were plated on 5% sheep blood TSA plates in the presence or absence of cysteine (0.1 mM) and hemolysis was documented after 48 h of incubation at 37°C. (B) M. hyorhinis beta-hemolysis is cysteine dependent. M. hyorhinis intact cells (50 μg) were incubated with sheep, chicken, or pig red blood cells (RBCs) at a final concentration of 2% packed cells for 18 h at 37°C. While no major hemolysis was observed in solution, the addition of cysteine (2 to 4 mM) increased hemolysis significantly. The hemolytic activity was monitored spectrophotometrically at 540 nm as described in Materials and Methods. The results are shown as means ± standard deviations of three separate sets of experiments. (C) Cysteine-dependent beta-hemolysis by M. hyorhinis purified membranes. M. hyorhinis purified membranes (50 μg) were incubated with sheep, chicken, or pig red blood cells (RBCs) for 18 h at 37°C in the presence or absence of cysteine (2 to 4 mM). The hemolytic activity was monitored spectrophotometrically at 540 nm as described in Materials and Methods. The results are shown as means ± SDs of three separate sets of experiments.
Many bacterial hemolysins are proteinaceous and are inactivated by heat and proteolysis (9). Interestingly, thermal treatment (boiling for 10 min) or proteolysis (treatment with 5 μg · ml−1 of proteinase K or 20 μg · ml−1 trypsin for 30 min at 37°C) of intact M. hyorhinis cells had no effect on the beta-hemolysis activity (data not shown). These results suggest that M. hyorhinis produces a heat- and proteolysis-stable hemolysin.
Some hemolysins (e.g., listeriolysin O, streptolysin O, and perfringolysin O) are pore-forming toxins. These hemolysins exhibit an absolute dependence on host cell membrane cholesterol, resulting in the formation of extraordinarily large pores and cell lysis (9). Interestingly, pretreatment of sheep RBCs with methyl-β-cyclodextrin (2 mM for 30 min), which depleted the membrane cholesterol level by 50% (23), had no effect on the beta-hemolysis activity of M. hyorhinis but inhibited the beta-hemolysis activity of Listeria monocytogenes by 50 to 60% (data not shown). These results suggest that the β-hemolysin of M. hyorhinis acts in a cholesterol-independent manner.
M. hyorhinis induces the reverse CAMP phenomenon.Beta-hemolysis activity of some pathogenic bacteria (e.g., S. agalactiae and L. monocytogenes) is associated with a putative CAMP-like factor (24, 25). Therefore, beta-hemolysis of M. hyorhinis was further characterized using the CAMP test as described in Materials and Methods. Analysis of the CAMP phenomenon in various Mycoplasma species revealed a positive CAMP phenomenon with M. fermentans, M. hominis, and M. gallisepticum, a negative CAMP phenomenon with M. pneumoniae, and the rare reverse CAMP phenomenon with M. hyorhinis, M. capricolum, and M. mycoides (as illustrated in Fig. 2). Interestingly, analysis of the CAMP phenomenon by M. penetrans revealed a unique CAMP phenotype, a positive CAMP phenomenon combined with the reverse CAMP phenomenon (Fig. 2).
CAMP effects of various Mycoplasma species. The CAMP test was performed using 5% sheep blood TSA plates as described in Materials and Methods. The CAMP reactions were documented after 48 h of incubation of the Mycoplasma species with S. aureus.
The reverse CAMP phenomenon was suggested to be attributable to the activity of PLD (14). M. hyorhinis does not possess PLD activity (19); however, we detected in M. hyorhinis the two conserved PLD domains [HKD motif HxK(x)4D(x)6GSxN] in the cls gene encoding cardiolipin synthetase (CLS) (GenBank accession number AEC45753.1) residing between residues 253 to 270 and residues 440 to 457 (Fig. 3A and B). Both PLD domains share close homology with the PLD active sites of the cloned Streptomyces sp. YU100 PLD (26) (Fig. 3B). Interestingly, we have found a correlation between the presence of the cls gene and the induction of the reverse CAMP phenomenon (Table 1) in representative Mycoplasma species. In all Mycoplasma species analyzed, the cls genes analyzed contained the two HKD motifs. This correlation raised the possibility that the reverse CAMP phenomenon, attributed to PLD activity (14), might also be induced by CLS.
Similar to the bacterial PLD amino acid sequence, the cardiolipin synthetase of M. hyorhinis contains two phospholipase D domains. (A) Amino acid sequence of the cardiolipin synthetase of M. hyorhinis (518 amino acids (aa); accession number AEC45753.1). Amino acid residue sequence in bold type and underlined corresponds to the two phospholipase D (PLD) domains. (B) The PLD motifs in the CLS of M. hyorhinis share close homology with the PLD active sites of Streptomyces sp. YU100. The PLD motifs from the M. hyorhinis CLS and the Streptomyces sp. YU100 PLD (GenBank accession numbers AEC45753.1 and ABY71835.1, respectively) were aligned and the sequence logo was generated using the Geneious software. The logo shows the information content at each position (CLS1, domain 1 of the PLD motif in CLS; CLS2, domain 2 of the PLD motif in CLS; PLD1, domain 1 of the PLD motif in PLD; PLD2, domain 2 of the PLD motif in PLD).
Correlation between the presence of the cls gene and induction of the reverse CAMP phenomenon
cls gene can induce reverse CAMP in M. gallisepticum.The association of the reverse CAMP phenomenon with CLS activity was further investigated by transforming the pMT85:cls construct (7.18 kbp) (Fig. 4A) harboring the cls gene (1.56 kbp) from M. hyorhinis or the pMT85 plasmid (as a negative control) into M. gallisepticum, which has neither the cls gene nor the reverse CAMP phenomenon. Successful transformation was confirmed by PCR with pMT85:cls-specific primers. The transformed mycoplasmas harboring pMT85:cls were able to induce transcription of the cls gene compared to the particularly unnoticeable transcriptional level in the transformants harboring pMT85 (Fig. 4B). The expression of cls was regulated by the heat shock-inducible promoter clpB; therefore, the induction of cls by M. gallisepticum (pMT85:cls) occurred only after heat shock induction of 42°C for 3 h (Fig. 4B). Furthermore, transformation of M. gallisepticum by the pMT85:cls plasmid, resulted in the rare reverse CAMP phenomenon, with M. gallisepticum transformants characterized by an inhibition of the beta-hemolytic activity of S. aureus at the junction between these two microorganisms (Fig. 4C). Since M. gallisepticum also had a positive CAMP phenotype, the overall picture was similar to the M. penetrans CAMP phenotype (Fig. 2). As expected, transformation of M. gallisepticum by the empty pMT85 plasmid, resulted in the positive CAMP phenotype, as shown in Fig. 2.
Cardiolipin synthetase (cls) induces the reverse CAMP phenomenon. (A) Description of the plasmid pMT85:cls. The plasmid was constructed by inserting the cls gene into the NotI and SfiI sites of the plasmid pMT85 (50), resulting in the plasmid pMT85:cls as described in Materials and Methods. (B) RT-qPCR analysis of cls by M. gallisepticum transformants. Transcription levels are presented as relative quantity (RQ), cls expression by M. hyorhinis versus M. gallisepticum transformants. mRNA levels were normalized to 16S rRNA. The data represent 2 biological repeats (n = 2). Error bars indicate a 95% confidence interval. Black bars, cls transcripts of mycoplasmas grown at 37°C; white bars, cls transcripts of mycoplasmas grown at 37°C and then heat shocked at 42°C for 3 h. As expected, the cls transcript is induced only after heat shock due to the heat-sensitive promoter of the pMT85. (C) The reverse CAMP effect is induced by M. gallisepticum (pMT85:cls) transformants. The transformants were grown at 37°C and then heat shocked at 42°C for 3 h before the CAMP test was carried out. The CAMP test was performed on 5% sheep blood TSA plates as described in Materials and Methods. CAMP reactions were photographed after 72 h of incubation of the transformants with S. aureus. A reverse CAMP was obtained by M. gallisepticum (pMT85:cls) and a positive CAMP reaction by M. gallisepticum (pMT85).
DISCUSSION
Bacterial hemolysins are important virulence factors found in many pathogenic microorganisms. Hemolysis implies disruption of the cell membrane, and the action of hemolytic factors and hemolysins are not confined to the membranes of blood cells (7, 27). Hemolytic activity has several possible roles during invasion of host cells by M. hyorhinis (18). Disruption of the host cell membrane would facilitate the invasion of M. hyorhinis and also provide access to nutrients released from within the host cells. We show here that M. hyorhinis possesses beta-hemolysis activity, resulting in total hemolysis of sheep RBCs. As shown with Leptospira interrogans (28), S. aureus (29), and certain Vibrio species (30–33), RBCs from different animal species have been shown to vary in their sensitivity to M. hyorhinis hemolysin. M. hyorhinis hemolysis was most pronounced with sheep and chicken RBCs. Fractionation of M. hyorhinis revealed that the hemolytic activity is located solely in the membrane fraction. Membrane-associated hemolytic activities were described in a variety of Mycoplasma species, including: M. pulmonis, M. hyopneumoniae, M. bovis, M. capricolum, M. gallisepticum, and M. pneumoniae (5, 8). It was suggested that the wide distribution of the membrane-associated hemolytic activity in mycoplasmas contributes to the survival of these microorganisms. Because of the unique structural and biochemical characteristics of mycoplasmas, these microorganisms acquire macromolecular precursors from their environment (5). During active infections, these are incorporated from host cell membranes and intracellular pools for fatty acids, phospholipids, cholesterol, and nucleic acid precursors.
A reducing agent such as cysteine was required for the hemolytic activity of M. hyorhinis. This requirement suggests that M. hyorhinis possesses an oxygen-labile hemolysin. Oxygen-labile hemolysins were detected in a variety of microorganisms (34–36). The observed cysteine-dependent hemolytic activity of M. hyorhinis suggests the presence of a sulfhydryl group that has to be in a reduced state for lytic activity. In other oxygen-labile hemolysins, the essential sulfhydryl group is contained in a single cysteine residue near the carboxy-terminal region of the hemolysin (34).
Another property of some oxygen-labile β-hemolysins is their dependency on host cholesterol. Such hemolysins are produced by Clostridium perfringens, S. pyogenes, and L. monocytogenes (9). These hemolysins are secreted soluble proteins, which upon encountering a eukaryotic cell, undergo a transformation from a soluble monomeric protein to a membrane-embedded supramolecular pore complex (34). The β-hemolysin of M. hyorhinis was neither cholesterol dependent nor inhibited by proteolysis or by heat treatment, suggesting the nonproteinaceous nature of this hemolysin. Heat- and/or proteolysis-stable hemolysins were described before (37–39), such as the heat-stable β-hemolysin of Pseudomonas aeruginosa, which was identified as a glycolipid (40).
A variety of bacterial species display a hemolytic cooperativity or a “CAMP-like” activity with S. aureus (11, 41–43), mainly used in classical diagnostics. In the vicinity of the culture of these species and a culture of S. aureus, a zone of enhanced hemolytic activity occurs (synergistic hemolysis). For example, pathogenic Listeria species produce a synergistic hemolysis with S. aureus (42) attributed to sulfhydryl-activated cytolysin and sphingomyelinase C activity. To date, this report is the first to describe the CAMP test in mycoplasmas. Analysis of the CAMP test in various Mycoplasma species revealed a positive CAMP reaction with M. fermentans, M. hominis, and M. gallisepticum; a negative CAMP reaction by M. pneumoniae; and reversed CAMP activity with M. hyorhinis, M. capricolum, and M. mycoides (antagonistic to hemolysis with S. aureus at the vicinity of the culture of these mycoplasmas). Interestingly, M. penetrans showed a unique phenotype composed of two CAMP phenomena, the positive CAMP and the reverse CAMP. We created this phenotype by transforming the CAMP-positive M. gallisepticum with the cls gene of M. hyorhinis, and therefore, we assume that these two phenomena are independent in mycoplasmas.
Indeed, previous studies have shown an association between the putative CAMP factor and virulence (44, 45). Rühlmann et al. (46) have shown that the CAMP factor of GBS, a 25-kDa protein named protein B, binds to immunoglobulins in a way similar to that of protein A of S. aureus. The revelation of the mycoplasmal putative CAMP factor merits further investigations.
The reverse CAMP phenomenon, described before in Corynebacterium pseudotuberculosis (13, 14), was suggested to be associated with PLD activity. We have shown previously that M. hyorhinis does not possess PLD activity (19, 47), and we were unable to detect the pld gene homolog in the M. hyorhinis genome. However, we identified the two conserved domains of PLD [HKD motif, HxK(x)4D(x)6GSxN] in the M. hyorhinis cls gene encoding CLS, a characteristic of all prokaryotic CLSs (48). Furthermore, the conserved HKD motif-containing PLD superfamily was shown to be a part of the active site of the enzyme (49), playing a role in the catalysis of phosphatidylcholine, the major membrane component of RBCs (51). The correlation between the presence of the cls gene and the induction of the reverse CAMP phenomenon by a variety of Mycoplasma species led to the possibility that the rare reverse CAMP phenomenon, previously shown to be associated with PLD activity (14), is induced in mycoplasmas by CLS. Indeed, the transformation of M. gallisepticum (which has neither the cls gene nor the reverse CAMP phenomenon) by the pMT85 plasmid harboring the cls gene from M. hyorhinis resulted in the rare reverse CAMP phenomenon with the M. gallisepticum transformants, suggesting for the first time that the reverse CAMP can be induced by CLS.
ACKNOWLEDGMENTS
We are grateful to Anat Hershkovits and Nadejda Sigal, University of Tel Aviv, Israel, for excellent technical assistance with this work, and we thank Richard Herrmann, University of Gottingen, Germany, for gifting the plasmid pMT85.
FOOTNOTES
- Received 7 January 2014.
- Returned for modification 5 February 2014.
- Accepted 24 February 2014.
- Accepted manuscript posted online 5 March 2014.
- Copyright © 2014, American Society for Microbiology. All Rights Reserved.
