ABSTRACT
Leishmaniasis in humans is caused by Leishmania spp. in the subgenera Leishmania and Viannia. Species identification often has clinical relevance. Until recently, our laboratory relied on conventional PCR amplification of the internal transcribed spacer 2 (ITS2) region (ITS2-PCR) followed by sequencing analysis of the PCR product to differentiate Leishmania spp. Here we describe a novel real-time quantitative PCR (qPCR) approach based on the SYBR green technology (LSG-qPCR), which uses genus-specific primers that target the ITS1 region and amplify DNA from at least 10 Leishmania spp., followed by analysis of the melting temperature (Tm) of the amplicons on qPCR platforms (the Mx3000P qPCR system [Stratagene-Agilent] and the 7500 real-time PCR system [ABI Life Technologies]). We initially evaluated the assay by testing reference Leishmania isolates and comparing the results with those from the conventional ITS2-PCR approach. Then we compared the results from the real-time and conventional molecular approaches for clinical specimens from 1,051 patients submitted to the reference laboratory of the Centers for Disease Control and Prevention for Leishmania diagnostic testing. Specimens from 477 patients tested positive for Leishmania spp. with the LSG-qPCR assay, specimens from 465 of these 477 patients also tested positive with the conventional ITS2-PCR approach, and specimens from 10 of these 465 patients had positive results because of retesting prompted by LSG-qPCR positivity. On the basis of the Tm values of the LSG-qPCR amplicons from reference and clinical specimens, we were able to differentiate four groups of Leishmania parasites: the Viannia subgenus in aggregate; the Leishmania (Leishmania) donovani complex in aggregate; the species L. (L.) tropica; and the species L. (L.) mexicana, L. (L.) amazonensis, L. (L.) major, and L. (L.) aethiopica in aggregate.
INTRODUCTION
Leishmaniasis is endemic in the tropics, subtropics, and southern Europe and encompasses diverse clinical syndromes, including cutaneous, mucosal, and potentially life-threatening visceral forms (1–4). Overall, leishmaniasis in humans is caused by ∼20 Leishmania spp. in the subgenera Viannia and Leishmania; >1 species may be found in the same geographic region. Species identification often has clinical relevance, such as implications regarding whether and which treatment is indicated and whether and how to monitor for potential sequelae of the infection (e.g., mucosal leishmaniasis, which is typically caused by New World species in the Viannia subgenus, particularly, but not only, by Leishmania [Viannia] braziliensis in certain geographic regions) (1, 3–7).
In the U.S. civilian sector, the reference laboratory of the Centers for Disease Control and Prevention (CDC) provides diagnostic identification of Leishmania spp. in human clinical specimens using parasitologic and molecular techniques. In contrast to the traditional parasitologic approach for Leishmania species identification (in vitro culture of parasites followed by isoenzyme analysis [multilocus enzyme electrophoresis]), molecular approaches are typically more sensitive, less labor-intensive, and more rapid (i.e., they provide results within days rather than weeks or months) (4, 8–11). The sensitivity, specificity, and utility of DNA-based methods for genus-, subgenus/complex-, and species-level characterization of Leishmania parasites have been discussed extensively (10–16).
Until recently, CDC's molecular algorithm for the diagnosis of leishmaniasis relied on a conventional PCR method that amplifies the rRNA internal transcribed spacer 2 (ITS2) region (ITS2-PCR), followed by DNA sequencing analysis of the amplicons to identify the species (17). The advantages of real-time quantitative PCR (qPCR) approaches in comparison with conventional PCR assays include the potential for increased sensitivity and specificity and for a decreased risk of contamination of the laboratory environment (14, 18–26). The efficiency of real-time platforms for Leishmania species identification has been discussed (24, 27–30). Although real-time PCR approaches have the potential for identifying different Leishmania spp. simultaneously, many of the described qPCR methods detect only some of the pertinent Leishmania spp. or strains (24, 27, 28, 30). Although assays that target minicircle kinetoplast DNA (kDNA) are the most sensitive PCR methods for detecting Leishmania parasites because of the abundance of minicircles in each kinetoplast (13, 29, 31, 32), the high-level sequence polymorphism among minicircles is a substantial limitation for systematic species identification solely on the basis of this marker.
The advantages of real-time PCR approaches and our observation of occasional ITS2-PCR-negative but culture-positive results in the CDC reference laboratory prompted us to develop a qPCR assay for the molecular diagnosis of Leishmania infection. We selected the ITS1 region as the target because of the high estimated number of copies of the rRNA gene (range, 40 to 200) per Leishmania species genome. Comparisons of the DNA sequences of the ITS1 region of some Leishmania spp. have shown interspecies variations and single nucleotide polymorphisms that have been useful for species identification and molecular typing (12, 17, 33, 34).
Here we describe our development and evaluation of a novel qPCR approach, based on the SYBR green technology (LSG-qPCR), which uses a genus-specific pair of primers that span the rRNA ITS1 region, followed by analysis of the melting temperature (Tm) of the amplicons on qPCR platforms. By using this methodology, we were able to differentiate four groups of Leishmania parasites: the Viannia subgenus in aggregate (L. [V.] braziliensis, L. [V.] guyanensis, and L. [V.] panamensis) (group 1 [G1]); the L. (L.) donovani species complex in aggregate (L. [V.] donovani and L. [L.] infantum/L. [L.] chagasi) (group 2A [G2A]); the species L. (L.) tropica (group 2B [G2B]); and the species L. (L.) mexicana, L. (L.) amazonensis, L. (L.) major, and L. (L.) aethiopica in aggregate (group 3 [G3]). Our results indicate that this method can serve as an efficient tool for presumptive species identification.
RESULTS
In our initial evaluations of the LSG-qPCR assay (in comparison with the ITS2-PCR approach), Leishmania DNA was amplified from all of the WHO reference markers and CDC cultured isolates. (See below for information regarding Tm analysis and species discrimination.) In further evaluations, among the specimens from 1,051 patients (1 specimen per patient) submitted to the CDC reference laboratory for Leishmania diagnostic testing, 477 specimens tested positive for Leishmania spp. with the LSG-qPCR assay, and 465 of these (i.e., 12 fewer specimens) also tested positive with the conventional ITS2-PCR assay. Specimens from a total of 574 patients tested negative with both assays.
The specimens from 477 patients that tested positive with the LSG-qPCR assay included 22 specimens with high cycle threshold (CT) values (CT values ≥ 36)—15 of which were extracts from paraffin-embedded tissue blocks or hematoxylin and eosin (H&E)-stained slides—that initially had negative results with the ITS2-PCR assay. However, for 10 of these 22 patients, positive ITS2-PCR results were obtained when either an aliquot of DNA extracted from a new specimen or a diluted aliquot from the original DNA extract was tested. The specimens from 7 of these 10 patients were paraffin-embedded tissue blocks; the positive ITS2-PCR results were obtained when diluted DNA aliquots were tested (5 patients) or when a new DNA extract was tested (2 patients). The specimens for the other 3 (of 10) patients were fresh tissue, and the positive ITS2-PCR results were obtained when aliquots of new DNA extracts from fresh tissue were tested. Species identification was not accomplished for the other 12 (of 22) patients because the ITS2-PCR results were negative (8 patients) or the amplicon concentration was too low to proceed with sequencing analysis (4 patients) even after retesting; six paraffin-embedded tissue blocks and two slide extracts had A260/A280 ratios consistent with poor-quality DNA.
Tm analyses of LSG-qPCR fragments.The 220- to 275-bp-long fragments amplified by LSG-qPCR (Fig. 1) from reference DNA (WHO and CDC isolates) and clinical specimens were subjected to Tm analyses. On the basis of the amplicons' Tm values observed with the Stratagene Mx3000P and ABI 7500 platforms, Leishmania spp. (as identified by conventional ITS2-PCR followed by DNA sequencing analysis) were classified into four groups, referred to here as G1, G2A, G2B, and G3 (Fig. 2A and B). The agreement regarding the presumptive species (or subgenus/complex) identification—i.e., the Viannia subgenus in aggregate (G1); the L. (L.) donovani complex in aggregate (G2A); the species L. (L.) tropica (G2B); and the species L. (L.) mexicana, L. (L.) amazonensis, L. (L.) major, and L. (L.) aethiopica in aggregate (G3)—was 100%. The median Tm values for the various Tm groups on the two platforms are provided in Tables 1 and 2. For each group, the median Tm value was ∼1.5°C higher on the Stratagene Mx3000P platform than on the ABI 7500 platform.
For reference sizes, amplicons from the LSG-qPCR and QC-qPCR were resolved on a 1.5% agarose gel. Lanes 1 and 5, 100-bp ladder size standards; lane 2, L. (V.) panamensis; lane 3, L. (L.) tropica (G2B); lane 4, L. (L.) aethiopica; lane 6, human beta-actin QC-qPCR fragment.
(A) SYBR green dissociation curve analyses of LSG-qPCR amplicons from the Stratagene Mx3000P platform. G1, L. (V.) braziliensis, L. (V.) guyanensis, and L. (V.) panamensis; G2A/B, L. (L.) infantum/L. (L.) chagasi and L. (L.) tropica; G3, L. (L.) amazonensis, L. (L.) mexicana, L. (L.) aethiopica, and L. (L.) major. (B) SYBR green dissociation curve analyses of LSG-qPCR amplicons from the ABI 7500 platform. *, L. (V.) braziliensis and L. (V.) panamensis (G1); **, L. (L.) infantum/L. (L.) chagasi and L. (L.) tropica (G2A/B); ***, L. (L.) mexicana and L. (L.) major (G3). QC, human beta-actin amplicons from quality control reactions. The melting temperature is the highest point of each curve.
Leishmania test results for patient specimensa analyzed by LSG-qPCR with the Stratagene Mx3000P platform
Leishmania test results for patient specimensa analyzed by LSG-qPCR with the ABI 7500 platform
Tm analyses with the Stratagene Mx3000P platform.Of the 603 patient specimens tested by use of the Stratagene Mx3000P platform, 279 had positive results and were classified by Tm group (Table 1). By comparison of the Tm values of the LSG-qPCR amplicons, the following Tm ranges were established for each group (some of which overlap): 78.4 to 79.5°C for G1, 79.5 to 80.2°C for G2A, 80.2 to 80.8°C for G2B, and 81.1 to 82.9°C for G3 (Table 1). By using the results of ITS2 sequencing analyses, the etiologic agents of the 142 cases of infection with Viannia spp. (G1) were identified to be L. (V.) braziliensis (n = 40 cases), L. (V.) guyanensis (n = 4), and L. (V.) panamensis (n = 98). In G2A, 40 cases of infection caused by species in the L. (L.) donovani complex were identified; in G2B, 20 cases of L. (L.) tropica infection were identified; and in G3, 27 cases of infection with L. (L.) mexicana, 2 cases of infection with L. (L.) amazonensis, 36 cases of infection with L. (L.) major, and 4 cases of infection with L. (L.) aethiopica were identified (Table 1).
Two specimens had a Tm value of 79.5°C, consistent with either G1 or G2A; one of the two was associated with a case of L. (V.) braziliensis infection (G1), and the other was associated with a case of infection caused by the L. (L.) donovani complex (G2A). Seven specimens had a Tm value of 80.2°C, consistent with either G2A or G2B; two of the seven were associated with cases of infection caused by the L. (L.) donovani complex (G2A), and five were associated with L. (L.) tropica infection (G2B). These overlapping Tm values for nine specimens were not resolved (i.e., the Tm values did not change and remained consistent with >1 group) after the testing and analyses were redone twice with different DNA extraction aliquots.
The 279 positive specimens identified by use of the Stratagene Mx3000P platform included 8 of the 12 for which the ITS2-PCR approach did not succeed in identifying the Leishmania species. The Tm values and, consequently, the Tm groups for these amplicons were supported by the patients' travel histories (data not shown); e.g., a specimen from a patient who had traveled to Costa Rica had a Tm value of 78.9°C (G1; consistent with the Viannia subgenus), and a specimen from a patient who had traveled to Israel had a Tm value of 82.3°C (consistent with G3). Figure 2A shows the dissociation curves obtained with the Stratagene Mx3000P platform in single peaks, which represent the results of Tm analyses.
Tm analyses with the ABI 7500 platform.Of the 448 patient specimens tested by use of the ABI 7500 platform, 198 had positive results and were classified by Tm group (Table 2). By comparison of the Tm values of the LSG-qPCR amplicons, the following Tm ranges were established for each group (some of which overlap): 76.8 to 77.9°C for G1, 78.0 to 79.0°C for G2A, 79.0 to 79.5°C for G2B, and 80.0 to 80.8°C for G3 (Table 2). By using the results of ITS2 sequencing analyses, the etiologic agents of the 88 cases of infection with Viannia spp. (G1) were identified to be L. (V.) braziliensis (n = 36 cases), L. (V.) guyanensis (n = 4), and L. (V.) panamensis (n = 48). In G2A, 28 cases of infection caused by species in the L. (L.) donovani complex were identified; in G2B, 17 cases of L. (L.) tropica infection were identified; and in G3, 28 cases of infection with L. (L.) mexicana, 2 cases of infection with L. (L.) amazonensis, 30 cases of infection with L. (L.) major, and 1 case of infection with L. (L.) aethiopica were identified (Table 2). Five specimens had a Tm value of 79.0°C, which can indicate either G2A or G2B; one of the five specimens was associated with an infection caused by the L. (L.) donovani complex (G2A), and four were associated with L. (L.) tropica infection (G2B).
The 198 positive specimens identified by using the ABI 7500 platform included 4 of the 12 specimens for which the ITS2-PCR approach did not succeed in identifying the Leishmania species. The Tm values and groups for these cases were also supported by the patients' travel histories (data not shown); e.g., a specimen from a patient who had traveled to Ecuador had a Tm value of 77.4°C (G1; consistent with the Viannia subgenus), and a specimen from a patient who had traveled to Israel had a Tm value of 80.6°C (consistent with G3). Figure 2B shows the dissociation curves obtained with the ABI 7500 platform in single peaks, which represent the results of Tm analyses.
QC reaction.Amplification of a beta-actin fragment (Fig. 1) was used to monitor the quality of the extracted DNA, to avoid having false-negative results because of poor DNA quality and/or PCR inhibitors. The quality control (QC) qPCR effectively amplified DNA from all of the clinical specimens that we tested, with the Tm values ranging from 85.3 to 86.8°C and from 84.6 to 85.8°C on the Stratagene Mx3000P and ABI 7500 platforms, respectively; i.e., the Tm values were higher than those for the Leishmania spp. (Fig. 2A and B). For most specimens, the CT values were in the range of 20 to 25; however, we noticed that CT values were ≥36 if DNA had been extracted from slides or paraffin blocks that had low parasite concentrations and/or poor A260/A280 ratios (data not shown).
When we prepared LSG-qPCR mixtures using DNA from other protozoa (e.g., Trypanosoma, Plasmodium, and Entamoeba spp.), we did not detect any amplified products (data not shown).
DISCUSSION
Our evaluations of the LSG-qPCR method demonstrated that it was highly efficient in differentiating at least 10 Leishmania spp. into four Tm groups that we referred to as G1, G2A, G2B, and G3. We selected the primers LSGITS1-F1 and LSGITS1-R1 because they could amplify DNA from multiple Leishmania spp. and yield amplicons separable into Tm groups and thereby could provide an additional level of confidence regarding the results obtained by the complementary ITS2-PCR approach that we used to identify the particular Leishmania sp. in a clinical specimen. When we tested clinical specimens from 1,051 patients on either of two platforms—the Stratagene Mx3000p or the ABI 7500 platform—the results were encouraging with both platforms. On the basis of the aggregate LSG-qPCR results for both platforms, we identified 477 Leishmania-positive cases, 465 of which (i.e., 12 fewer cases) were confirmed by the ITS2-PCR assay. The presumptive species (or subgenus/complex) identifications based on the LSG-qPCR amplicons' Tm values (and the Tm groups) were concordant with the ITS2-PCR species identifications—i.e., the Viannia subgenus (G1); the L. (L.) donovani complex (G2A); the species L. (L.) tropica (G2B); and the species L. (L.) mexicana, L. (L.) amazonensis, L. (L.) major, and L. (L.) aethiopica (G3)—with the exceptions involving issues associated with overlapping Tm values and specimens that tested positive by only one approach.
In this investigation, use of the LSG-qPCR assay facilitated the diagnosis of leishmaniasis in 22 patients whose specimens had negative or equivocal results by ITS2-PCR but positive results by LSG-qPCR with CT values of ≥36. It was not surprising that some of the extracts from paraffin-embedded tissue blocks and H&E-stained slides tested negative or that the results for some of the specimens with initially negative ITS2-PCR results were resolved; PCR inhibition and spurious results associated with DNA extracted from formalin-fixed specimens have been reported and resolved by other investigators (20, 35). Because of our presumptive positive results with the LSG-qPCR assay, a new specimen or a new aliquot of the first specimen was (re)tested by the ITS2-PCR, which otherwise would not have been performed. Because of this retesting prompted by the LSG-qPCR results, specimens from 10 of the 22 patients whose ITS2-PCR results were initially negative ended up testing positive by ITS2-PCR after all, such that DNA sequencing analysis could be performed and the Leishmania species could be definitively identified. For the 12 patients whose specimens tested positive only by LSG-qPCR and were not resolved by the ITS2-PCR approach even after retesting, the Tm group results were epidemiologically plausible in the context of the patients' travel histories. However, the LSG-qPCR results alone did not suffice for final species identification.
We attribute the overlapping Tm values that we observed with both platforms to the variability in the intraspecies microsatellite repeats in the ITS1 region in the Leishmania genus. These intraspecies variations cannot be predicted. They apparently result from the low functional constraint over the ITS rRNA spacer regions compared with that over the functional parts of the gene, including 18S, 5.8S, and 28S rRNA (36, 37). We also observed that the median Tm values for the various Tm groups were ∼1.5°C higher when the Stratagene Mx3000P platform was used than when the ABI 7500 platform was used, even though the reagents and reaction protocol were the same for both platforms. However, regardless of which platform was used, all three species of the Viannia subgenus identified in this investigation by the ITS2-PCR approach—i.e., L. (V.) braziliensis, L. (V.) guyanensis, and L. (V.) panamensis, all three of which can be associated with mucosal leishmaniasis, although the risk varies by parasite and host factors—clustered together in G1. Both species in the L. (L.) donovani complex, which are the primary etiologic agents of visceral leishmaniasis and which can also cause cutaneous leishmaniasis, clustered together in G2A. G2B contained only L. (L.) tropica, an anthroponotic cause of cutaneous leishmaniasis in the Old World. Finally, zoonotic non-Viannia subgenus species that cause cutaneous leishmaniasis—L. (L.) mexicana and L. (L.) amazonensis (in the New World) and L. (L.) major and L. (L.) aethiopica (in the Old World)—clustered together in G3 (Tables 1 and 2). We do not yet have data regarding the Tm group classifications for Leishmania spp. that were not included in the investigation.
We used the human beta-actin QC reaction, which was designed to run side-by-side with the LSG-qPCR assay, as an independent reaction in a separate PCR tube. On both platforms, the Tm values for the QC amplicons were higher than those for the Leishmania spp.; therefore, the reactions could be analyzed simultaneously in the same run. We decided to use an endogenous (rather than an exogenous) internal control target for the particular diagnostic application that we described, to help confirm the structural integrity of the DNA extracted from paraffin-embedded tissue blocks and H&E-stained histopathology slides, as well as to help ensure that PCR inhibitors were not present in these specimens. Paraffin-embedded tissue blocks constitute a substantial minority of the specimens that CDC receives for diagnostic testing for leishmaniasis but can present challenges for molecular testing (as can histopathology slides); two of the potential causes of PCR inhibition include DNA-protein cross-links and the fragmentation of nucleic acids (35).
In summary, the LSG-qPCR can amplify at least 10 Leishmania spp. that infect humans—including etiologic agents of cutaneous, mucosal, and visceral leishmaniasis—and allows rapid presumptive species identification, particularly if the Tm results are interpreted in the context of the patient's residence and travel history. The fact that presumptive species identification can be accomplished by use of a single pair of primers, thereby minimizing the risk for contamination, not only is advantageous for reference diagnosis of leishmaniasis but also is a noteworthy difference from other molecular approaches described for the detection of Leishmania. We have incorporated the LSG-qPCR assay into CDC's algorithm for the laboratory diagnosis of leishmaniasis. Whenever we obtain a positive LSG-qPCR result, we conduct conventional ITS2-PCR and sequencing analysis for definitive species identification.
MATERIALS AND METHODS
For the ITS1-specific SYBR green PCR (LSG-qPCR) assay, we designed primers LSGITS1-F1 (CATTTTCCGATGATTACAC) and LSGITS1-R1 (CGTTATGTGAGCCGTTATC) on the basis of multiple alignments of the rRNA ITS1 region from the species L. (V.) braziliensis, L. (V.) guyanensis, L. (V.) panamensis, L. (L.) mexicana, L. (L.) amazonensis, L. (L.) donovani, L. (L.) infantum/L. (L.) chagasi, L. (L.) major, L. (L.) tropica, and L. (L.) aethiopica; the primers amplify DNA fragments of ∼220 to 275 bp in length, depending on the species. During our initial evaluations of the LSG-qPCR approach, we compared the results of the LSG-qPCRs obtained on qPCR platforms (see below) with the results of the ITS2-PCR approach, i.e., ITS2-PCR followed by DNA sequencing analysis of the amplicons for final species identification (17). However, we used epidemiologic/geographic criteria to distinguish between L. (L.) donovani and L. (L.) infantum/L. (L.) chagasi (e.g., the latter but not the former is found in Latin America and southern Europe), which are not reliably distinguished by either of our molecular approaches.
Specimens tested.For our initial evaluations of the LSG-qPCR procedure, we used DNA purified from the following WHO reference markers: L. (V.) braziliensis (MHOM/BR/75/M2903), L. (V.) guyanensis (MHOM/BR/75/M4147), L. (V.) panamensis (MHOM/PA/71/LS94), L. (L.) mexicana (MNYC/BZ/62/M379 and MHOM/BZ/82/BEL21), L. (L.) amazonensis (IFLA/BR/67/PH8 and MHOM/BR/73/M2269), L. (L.) donovani (MHOM/IN/80/DD8 and MHOM/ET/67/HU3), L. (L.) infantum (MHOM/TN/80/LEM235), L. (L.) chagasi (MHOM/BR/74/M2682), L. (L.) aethiopica (MHOM/ET/72/L100), L. (L.) major (MHOM/IL/67/JERICHO II and MHOM/SU/73/5-ASKH), and L. (L.) tropica (MHOM/SU/74/K27 and MHOM/SU/58/L39). We also included DNA from 22 cultured isolates (2 isolates of each species listed above) from CDC's collection, identified by species using isoenzyme analysis and ITS2-PCR followed by sequencing analysis, as described elsewhere (17).
We further evaluated the LSG-qPCR methodology by prospectively comparing the results obtained with the LSG-qPCR and conventional ITS2-PCR approaches for 1,051 patient specimens (1 specimen per patient was counted) submitted to CDC from 2010 to 2015 for Leishmania diagnostic testing (Tables 1 and 2). The clinical specimens included fresh (75%) or paraffin-embedded (17%) biopsy specimens of skin, bone marrow aspirates (5%), whole blood (2%), and histopathology hematoxylin and eosin (H&E)-stained slides (from paraffin-embedded skin biopsy specimens) (1%).
DNA extraction and quality control.Genomic DNA was extracted and purified directly from the fresh clinical specimens (<25 mg of tissue and 200 μl of whole blood or bone marrow aspirates) by using a DNeasy blood and tissue kit (Qiagen), following the manufacturer's instructions. Paraffin-embedded tissue blocks and H&E-stained slides of clinical specimens were prepared as follows before the DNA extraction procedure: tissue was removed from the paraffin blocks or scraped from the slides, placed in a microcentrifuge tube, and rehydrated with sterile water and 3 cycles of 56°C for 30 min. Each extraction batch included a negative extraction control, which consisted of a Leishmania-free eukaryotic cell culture sample (E-6 cells in RPMI medium). We assessed the concentration and purity (A260/A280 ratio) of each purified genomic DNA by using a NanoDrop 2000 spectrophotometer (Thermo Scientific). We used separate rooms for DNA extraction, PCR master mix preparation, DNA loading onto the master mix, loading of the positive control, and PCR runs.
As a control reaction for the quality of the DNA extraction, all DNA extracts were tested by using a quality control (QC) qPCR (QC-qPCR) with primers BACTF (CGTGACATTAAGGAGAAGCTGTGC) and BACTR (CTCAGGAGGAGCAATGATCTTGAT), which amplify a 374-bp-long fragment of the human beta-actin gene. We adapted this QC reaction from a method described elsewhere (38) for use in a SYBR green assay format. The LSG-qPCR and QC-qPCR were separate reactions (in separate PCR tubes) in which the reaction mixtures were prepared by use of the same chemistry and cycling parameters.
PCR preparation, conditions, and interpretation.The LSG-qPCR and QC-qPCR mixtures were prepared to a final volume of 20 μl by using 10 μl of 2× QuantiTect SYBR green PCR master mix (Qiagen), 10 μM each primer LSGITS1-F1/LSGITS1-R1 or BACTF/BACTR, ∼100 ng of genomic DNA template, and sterile water to adjust the reaction volume. A blank control reaction with sterile water instead of DNA (in addition to the negative DNA extraction control) was included in each PCR run. A positive control consisted of ∼10 ng of DNA extracted from Leishmania cultures. PCRs were run on either of two different qPCR platforms—the Stratagene Mx3000P qPCR system (Stratagene-Agilent) or the ABI 7500 real-time PCR system (ABI Life Technologies)—using the following cycling parameters: 95°C for 15 min and 40 cycles of 95°C for 15 s and 60°C for 1 min. Fluorescence data were collected at the end of each 60°C plateau. To differentiate among Leishmania spp., we analyzed the amplicons' Tm values, using 1 cycle of 95°C for 1 min, 60°C for 30 s, and 95°C for 1 min. Fluorescence data were collected at the 60 to 95°C ramps.
Ethics statement.The clinical specimens were tested in accordance with a CDC-approved protocol for the use of residual specimens from human subjects.
ACKNOWLEDGMENT
We are indebted to Richard Bradbury from the Centers for Disease Control and Prevention, Atlanta, GA, for invaluable assistance in reviewing the manuscript.
The findings and conclusions in this report are those of the authors and do not necessarily represent the official position of CDC.
FOOTNOTES
- Received 20 August 2016.
- Returned for modification 12 September 2016.
- Accepted 1 November 2016.
- Accepted manuscript posted online 9 November 2016.
- Copyright © 2016 American Society for Microbiology.
