Article Figures & Data
Figures
- FIG 1
Validation of T-cell measurement by targeting the unrearranged T-cell receptor in comparison to flow cytometry. (A) Study design and sample composition. Extracted genomic DNA from frozen blood, PBMCs, and bronchoalveolar lavage and sputum samples obtained from a remote Indigenous Australian HTLV-1c cohort was used to measure T cells by a generic single duplex ddPCR assay. Viable cellular material isolated in whole blood and PBMCs from the same HTLV-1c cohort was used to measure T cells by the gold standard method of flow cytometry. (B) Schematic depiction of T-cell receptor β (TCRβ) loci and the oligonucleotides (black arrows) and probes (pink star) used for detecting non-T cells (diversity [Dβ1]-joining [Jβ1]) and all cells (constant region 2 [Cβ2]). (C) Validation of oligonucleotide specificity for detecting TCRβ rearrangement. Only cells that have not undergone TCR rearrangement present intact Dβ1-Jβ1 primer-binding regions and will result in a 143-bp amplicon (designated Dβ1). The Cβ2 primers resulted in a 218-bp amplicon since this region remains intact at the DNA level during V(D)J recombination. The RPP30 primers resulted in a 62-bp amplicon of all samples containing human gDNA. NTC, nontemplate control. (D) A one-dimensional (1-D) ddPCR profile on Ch1 demonstrates the Dβ1 primer specificity to amplify samples containing non-T cells or cells that have not undergone V(D)J recombination (HEK and PBMC) (Dβ1+, blue droplets; Dβ1−, black droplets); the Ch2 1-D profile targets the ubiquitous housekeeping gene, RPP30 (RPP30+, green droplets; RPP30−, black droplets), which allows absolute quantification of total cells. Amplitude threshold is represented with a pink line. (E) Comparison of T-cell quantification by FACS to that by ddPCR. Determined T-cell fractions of 18 healthy PBMC donors are plotted jointly for direct comparison of the two quantification methods. Bars indicate mean values with SDs (FACS, 29 ± 18.6; ddPCR, 26 ± 17.6) (Wilcoxon matched-pairs test, P = 0.6705; ns, nonsignificant).
- FIG 2
Comparison of T-cell quantifications between ddPCR and flow cytometry in sorted cellular populations. (A) Flowchart of FACS sorting strategy. PBMC samples from 6 healthy donors were sorted into non-T-cell (NK cells, monocytes, and B cells) and T-cell populations (CD8+, CD4+, and γδ), followed by DNA extraction. (B) Purity checks of the various sorted cellular populations. (C) Total fraction of T cells measured in each sorted population from healthy donors by ddPCR and FACS. The distributions of measured cell subsets were very similar, which did not result in a significant difference between the ddPCR and FACS assays (P = 0.7559, Mann-Whitney test). (D) Correlation of ddPCR- and FACS-measured T cells in sorted populations of T cells and non-T cells from healthy donors resulted in a positive correlation (P < 0.0001; r = 0.9506).
- FIG 3
Relative distribution of HTLV-1c PVL measured in peripheral blood and various exudates from a remote Indigenous Australian cohort. HTLV-1c PVL per genome and PVL per T cell were measured in HTLV-1c-infected (+ve) peripheral blood (red), induced sputum (green), and bronchoalveolar lavage (BAL; blue) samples from remote Indigenous Australian cohort participants. PBMCs from healthy indigenous volunteers (−ve) were used as a negative control (open black circles). Box mid-line represents median value with interquartile range. Three subjects, represented by triangles, squares, and diamonds, donated both blood and sputum samples. Isolated gDNA from one BAL and one sputum sample was insufficient for PVL per T-cell assay. *, P < 0.05; **, P < 0.01; ***, P < 0.001.
Tables
- TABLE 1
Details for primers and probes used for ddPCR quantification of HTLV-1c and T cellsa
Oligonucleotide Strand Sequence (5′→3′) Annealing temp (°C) Purpose Primers for ddPCR for HTLV-1c and RPP30 primers 3083 + CAAATGAAGGACCTACAGGC 58 Production of HTLV-1c gag fragment 3084 − TATCTAGCTGCTGGTGATGG 61 Production of HTLV-1c gag fragment 3085 + TCCAGGCCTTATTTGGACAT 59 Production of HTLV1c tax fragment 3086 − CGTGTGAGAGTAGGACTGAG 59 Production of HTLV1c tax fragment Probes for ddPCR for HTLV-1c and RPP30 3321c + FAM-ACCATCCGGCTTGCAGT-MGBNFQb 58 Detection of HTLV-1c gag 3318c − FAM-CATGATTTCCGGGCCTTGC-MGBNFQ 61 Detection of HTLV-1c tax Primers for ddPCR for TCRβ gene region 3095 + TGTACAAAGCTGTAACATTGTGGGGAC 61 Amplification of TCRβ exon 1 of diverse region 1 3096 − AACCAAATTGCATTAAGACCTGTGACC 60 Amplification of TCRβ upstream intron of joining region 1 3157 + TCCGGTAAGTGAGTCTCTCC 55 Detection of TCRβ constant region 2 3158 − ATACAAGGTGGCCTTCCCTA 55 Detection of TCRβ constant region 2 Probes for ddPCR for TCRβ gene region 3191c + ACAATGATTCAACTCTACGGGAAACC 59 Detection of TCRβ exon 1 of diverse region 1 3159c − CGTGAGGGAGGCCAGAGCCACCTG 68 Detection of TCRβ constant region 2 - TABLE 2
Purity check of FACS-sorted cell populations and percent T cells measured by ddPCR
Cell type % purity of FACS-sorted population % T cells in ddPCR measure T cell PBMC1 PBMC2 PBMC3 PBMC4 PBMC5 PBMC6 PBMC1 PBMC2 PBMC3 PBMC4 PBMC5 PBMC6 CD8+ 98.7 97.2 95.8 92.8 93.2 91.3 97.3 97.0 98.0 95.3 96.7 97.1 CD4+ 98.4 97.0 98.2 92.6 97.6 94.6 95.9 95.8 95.3 94.9 95.4 95.5 γδ+ 97.0 94.5 89.6 91.5 55.2 65.1 62.1 61.7 46.8 58.2 66.0 45.2 Non-T cell NK cell 99.5 99.9 99.0 95.1 94.4 95.3 0.9 0.0 0.9 5.9 4.9 0.2 Monocyte 92.9 89.5 78.5 93.9 92.5 77.7 1.6 5.3 0.0 1.7 2.2 0.0 B cell 96.4 92.1 90.9 97.7 94.0 94.7 3.3 5.5 8.6 5.4 3.5 1.0
Supplemental material
- Supplemental file 1 -
Fig. S1 (ddPCR limit of detection of UTCR assay) and S2 (Sequential gating to identify specific leukocyte subsets) and Tables S1 (Detailed summary of 29 blood donors from remote Central Australian indigenous HTLV-1c cohort) and S2 (Detailed summary of 9 inflammatory exudate donors from remote Central Australian indigenous HTLV-1c cohort)
PDF, 1.8M
- Supplemental file 1 -
