TABLE 2.

Primer sequences of oligonucleotides used for PCR ribotyping and conventional PCR in this study

PrimerNucleotide sequence (5′-3′)GeneFragment length (bp)
PROsaCTGGGGTGAAGTCGTAACAAGGITScVariable
PROasGCGCCCTTTGTAGCTTGACC
PRBsbGTGCGGCTGGATCACCTCCTITSVariable
PRBasCCCTGCACCCTTAATAACTTGACC
282BacSGAAAARGTACTCAACCAAATAerm(B)639
283BacASAGTAACGGTACTTAAATTGTTTAC
NKV011TTTTGATCCTATAGAATCTAACTTAGTAACtcdA2,535
NK9CCACCAGCTGCAGCCATA
NK104GTGTAGCAATGAAAGTCCAAGTTTACGCtcdB204
NK105CACTTAGCTCTTTGATTGCTGCACCT
  • a PRO, PCR ribotyping by O'Neill method.

  • b PRB, PCR ribotyping by Bidet method.

  • c ITS, internal spacer region.