TABLE 2.

Primers for 78 sequence repeat loci used for polymorphism analysis of the region

Repeat and locusPosition in genomeaSSRForward primerForward primer size (bp)Reverse primerReverse primer size (bp)
Mononucleotide
    17930911793091-1793109GGGGGGGGGGGG GGGGGGGGTCAGACTGTGCGGTATGGAA20GTGTTCGGCAAAGTCGTTGT20
    27190852719085-2719094GGGGGGGGGGGTGACCAGTGTTTCCGTGTG20TGCACTTGCACGACTCTAGG20
Dinucleotide
    38038143803814-3803824GC GC GC GC GC GACCGAGCCGATAGTCATCAG20CAGCAGCAGCGAGTACGA18
    38407913840791-3840801GC GC GC GC GC GCTCGATTCGCGATCAGGT18CAACTTGACGCCCTGGTACT20
    607784607784-607794CG CG CG CG CG CATCCAACGCCATGTACTCGT20GAGCAGCATCGAGGTGAAAC20
    914968914968-914978CG CG CG CG CG CGACTAGGCCCTTGCGGTATC20CGCAACGTGCTGTCGTAG18
    32946843294684-3294693GC GC GC GC GCGGCAACGCCTCGTACACC18CCTACCCGAGCGGTCACT18
    33637823363782-3363791AC AC AC AC ACAGCGGCTCAATTACACACAA20ATCAGGTCCGGAATCACCTT20
    34063643406364-3406373GC GC GC GC GCGTTCTCGATGGACAGCTTGC20GGAGGACGAACCACACTCAT20
    34244693424469-3424478CG CG CG CG CGACCGGTTTCAGACAATGGAG20GTACGGCGAGCTACGCTATC20
    34567383456738-3456747GC GC GC GC GCAGCACAAGAAGCACCGGTAT20GGATCAACCTCGAGATCCTG20
    34587123458712-3458721CG CG CG CG CGACCAACTGCAGATCCTCGAT20GTAATCCCAGCCGGTTCAT19
    35735873573587-3573596CG CG CG CG CGATCGCCGACTATCTCAATCC20ACCGCCAGATAGTGAATTGC20
    36768173676817-3676826CG CG CG CG CGACCCGGACACGACGTAGC18GTTCGACATCGTGCACCTC19
    37353423735342-3735351GC GC GC GC GCTGTCGAACTTGCTCTTGGTG20CGTCCTGCAACATCTTCTCC20
    37542363754236-3754245GC GC GC GC GCACACGTAGTCGGTGGAGACG20GTTGCAATCACACGAACCAC20
    38313503831350-3831359GC GC GC GC GCGCACGCATCTGTTCAACG18CACAACAAGATTGGCCTCAG20
    39518413951841-3951850CG CG CG CG CGACGCCGCACTACGAATATCT20ACATCTCGAAGGACGTTTCG20
    40864044086404-4086413GC GC GC GC GCAGTCGCTGGGTTTTCAGGA19ATACCGCACGGTGTTCTGAT20
    41590744159074-4159083GC GC GC GC GCTATTCGGGTCCATGCTCAAT20ATGTGACGGAGGTCACACTG20
    41766094176609-4176618CG CG CG CG CGTTCATCGACTACCGGCTCTT20TGTTGGGGGACCATGTAACT20
    44654884465488-4465497CG CG CG CG CGAAGCTGAACTGGTGGGAGAG20GTCGAAAACGCTGTCGTAGG20
    45183354518335-4518344CG CG CG CG CGCTTTGGTTCCCAGCAGCAT19GGAGTATTCACCCGACCAAA20
    47173224717322-4717331GC GC GC GC GCTACCAACATCCCGACCTGAC20CGTAGGGGATAACCTGCTGA20
    1447414474-14483GC GC GC GC GCATACCTGCGTCCGATACCAG20GCTTTCATGATCACCGGTTT20
    7046170461-70470CG CG CG CG CGCGATGGCCTACTTCATCGTC20CGGCCGAAATAGATGATGTT20
    7093070930-70939GC GC GC GC GCCGATCACCCAGCAGTATGTG20ATCAGCTCCTTGGTCACCTG20
    7801278012-78021GC GC GC GC GCCCATGCTACGAGGTCGAGTT20TTGGGGAATAAACGACTTGC20
    191084191084-191093GC GC GC GC GCCAGCCGCAACGACTTCTC18TTAGGGTTGGCTTCCCATTA20
    219320219320-210329GC GC GC GC GCTTGTCCAGCAAGCAGAAGTG20ATAGTGCACCCCCAGCAC18
    274406274406-274415TG TG TG TG TGAGTGGAGGCTGAGATGTTGG20GGTGAACACCTTGCCGTTAT20
    429640429640-429649GC GC GC GC GCAAGTACATCCCGCTGCACAC20CGATTACCAGGTGCACGAC19
    676774676774-676783GC GC GC GC GCGCGAAATAACCGTTCACCTC20GACACCACCTGCGAGTAACC20
    686290686290-686299CA CA CA CA CAAGATCGCATCAAAGAGCACCT21GGTGAGTTGTCCGCATCAG19
    762468762468-762477CG CG CG CG CGGTCGACCCGAAGAGTGAGTG20GAATTTTTGGGGTCGTGATG20
    899250899250-899259CG CG CG CG CGAGAAAATAGCTGCGGTCGAA20GGATCGACACCCTGACCTC19
    909353909353-909362CG CG CG CG CGCGATCTCATACACCGTCGTC20AGGTGAACCGTAAGCGACAC20
    970000970000-970009CG CG CG CG CGTCGAGACCTCAAAAGCCTTG20GGGGACCTGCTGGTGATAG19
    28924612892461-2892470GT GT GT GT GTGGGTTGGTCTACGTTTGTCG20CCACAGCCCCTCGTAGTG18
    28873992887399-2887408CG CG CG CG CGAGCTGTACCGCGACTACCAC20AGCAACCGCGAATATGGTC19
    28315332831533-2831542GC GC GC GC GCCTGTTCGCCTACGTGCTGTA20GGGGTGGAGACGATGAAATA20
    28089892808989-2808998CG CG CG CG CGGGTGCGCGATAATGAAACTC20AAGACCACGCTGGTGAATCT20
    21038152103815-2103194GC GC GC GC GCGACCAGTTCCGGGCTCAC18AGGAACTGTTCAACCCGATG20
    27166622716662-2716671CA CA CA CA CAACCGATCTGGAAGAACATCG20GCCCTGGTCATTACACGACT20
    27095052709505-2709514CG CG CG CG CGGAGGTCGTCTTCCGTTACGA20CTCGTCGACCAGCAGTATGG20
    26153432615343-2615352GC GC GC GC GCAGGAAGGCGTCGACAAGAT19GAGGTGTCGTGCTTGGAGAT20
    25838502583850-2583859CG CG CG CG CGCGGCTTCGTATTGTCGTCTT20GGTCATGAGCAGAACCTTCC20
    25825232582523-2582532CA CA CA CA CACAGATCGCATCAAAGAGCAC20GGTGAGTTGTCCGCATCAG19
    25409682540968-2540977GC GC GC GC GCATTCAACCAACAGCCTCAGC20TAGCCGTTACCGGTGTTGAT20
    25191202519120-2519129CG CG CG CG CGCCCACCAGGTCGAAGAAAT19CAACTGGAGGACCAGGTGTT20
    25099612509961-2509970GC GC GC GC GCGCATCTCCACCCAGAAATTG20GAACACGTCGGTCTTGGTTT20
    22896422289642-2289651GC GC GC GC GCGATCGAAGACCGAAAACGTC20AGATCATCGGTGAGCTGGAG20
    22597262259726-2259735GC GC GC GC GCGAAGGGTCGTTCATGTTGCT20CAACTTACGGACCTGGGATG20
    20598172059817-2059826GC GC GC GC GCGTCGGGTTCTTCGTCAACAC20ATCGGTATCCATCAGGTCCA20
    19609671960967-1960976GC GC GC GC GCGCATTGCGCTACCTGAGTC19TCGACGAGAACATCACGAAC20
    18602481860248-1860257CG CG CG CG CGACCTGCAGACCGACGATTAC20ACTTGCTCACCGAGAACAGC20
    18414441841444-1841453CG CG CG CG CGGCAGCTTGTCCAGATCGAA19AAAAAGCAGCGACACCAGAC20
    18291291829129-1829138CG CG CG CG CGGAGGACCACGTGAAAATCGT20GGATCCTGCACCAGAACCT19
    17872051787205-1787214CG CG CG CG CGTGATCATCATGGAAGCCAAC20GCGGGAATGTTGATAAGGAA20
    17582851758285-1758294CG CG CG CG CGGATCATCCAATCGGTGTCCT20GCACACTCGTAATCGCTCAA20
    17077361707736-1707745GC GC GC GC GCGACCACCAAAACTGGTTTCC20GTCCGGTAGTGGTCGATGTC20
    16844411684441-1684450GC GC GC GC GCCAGGAACTGTGGGATGTCCT20CTGTACGGCTATTCGGTGGT20
    16640731664073-1664082CG CG CG CG CGTTCTGGCCGAATTGATCTCT20ATCGTTTTTGCCTGAATTGG20
    15266241526624-1526633GC GC GC GC GCGTCACCATCCGGTACATTCC20GAGGTGCCCAAGACGTATCT20
    12574951257495-1257504CG CG CG CG CGGGGATCCTGTGGCAGATAAC20CAACTGCTGGACACCTGCTA20
Trinucleotide
    42860684286068-4286084GCG GCG GCG GCG GCG GCGAATCGTCTTGCCTCACTGG20TCGAGCAACTGATCTCCACA20
    43109324310932-4310948CCG CCG CCG CCG CCG CCCGGCAATACCTCGAACAGAT20GCTGAAGAGGTCGTGCAGAT20
    440731440731-440747TGG TGG TGG TGG TGG TGCAGCGTGATCTGCGACCT18GATCAGCGAACTGCTCACG19
    10281291028129-1028145GGT GGT GGT GGT GGT GGAGATGTCGACCATCCTGACC20AAGTAGGCGTAACCCCGTTC20
    29553622955362-2955378TGC TGC TGC TGC TGC TGGACAAGTTCGGGTTGACCAC20AGTTCCTCGACCCAGTCGT19
    35580753558075-3558090GCC GCC GCC GCC GCC GCTGGAACGTGTCCGAATTG19GTATTCGGTGCGGATCTCCT20
    16534141653414-1653429CGC CGC CGC CGC CGC CTGAGCAGGAACCAGATCTCC20GTGGGGTGGATGAGTACGAC20
    16519201651920-1651935CGC CGC CGC CGC CGC CAGCATCTTGAGCCCACATCT20CCGAAATCAATTCTGGTCGT20
    31825093182509-3182523GCG GCG GCG GCG GCGCGGTCAGGTCGCAGATTT18GGTCAGCGAGAAACCACTTG20
    35624153562415-3562429CTG CTG CTG CTG CTGCTGGCATTGGGAATGTTCTT20CAGCACCATGTAGCCGATCT20
    212174212174-212188CGA CGA CGA CGA CGACAGAGCGGACTGCATTGAG19TCGGTGTTGTCCGGATTC18
    17370561737056-1737070GCG GCG GCG GCG GCGGCTCGTTGCAGGTCAGGTAG20GGCATGATCACCGAAAGC18
    15367981536798-1536812CCG CCG CCG CCG CCGCTGGAGTGGAAGAGCAGTCC20GCTGCGTTACCTCAACACC19
  • a The position in the genome is the coordinate of the SSR locus in the M. paratuberculosis strain K10 genome (GenBank accession number AE016958).