TABLE 2.

Primers and probes used in this study

ReferencePrimer or probe (name)Sequence (5′→3′)Tm(s)a (°C)Position (bp)bFluorophore and quenchercAmplicon length (bp)
This studyForward primer (CVCf)GGGCTACACACGTRCTACAATG59.2, 53.71220-1241167
Reverse primer (CVCr)CCGGGAACGTATTCACCG581386-1369
Probe (CVC-P)CGATTACTAGCGATTCC68.21353-13375′ VIC, 3′ MGBnfq
17 Forward primer (P891F)TGGAGCATGTGGTTTAATTCGA59.1943-964159
Reverse primer (P1033R)TGCGGGACTTAACCCAACA58.61101-1083
Probe (UniProbe)CACGAGCTGACGACARCCATGCA69.5, 67.31074-10525′ TET (original study used VIC), 3′ TAMRA
13 Forward primer (Nf)TCCTACGGGAGGCAGCAGT59.4340-358467
Reverse primer (Nr)GGACTACCAGGGTATCTAATCCTGTT58.1806-781
Probe (N-P)CGTATTACCGCGGCTGCTGGCAC69.9537-5155′ 6-FAM, 3′ TAMRA
  • a Tms were calculated with Primer Express software (Applied Biosystems).

  • b Numbered according to the E. coli O157:H7 rrsA gene (GenBank accession number AB035920 ).

  • c MGBnfq, minor groove binder nonfluorescent quencher (ABI); TET, tetrachloro-6-carboxyfluorescein; 6-FAM, 6-carboxyfluorescein.