TABLE 2.

PCR primers for amplifying Southern hybridization probes

ProbeSize (kb)PositionPrimer (5′-3′)Conditions
invA11.267invATCCCTTTGCGAATAACATCC (invA1/F)94°C/5 min; 35 cycles of 94°C/30 s, 55°C/1 min, and 72°C/1 min 30 s; and 72°C/10 min
TACGGTTCCTTTGACGGTGC (invA1/R)
invA21.736invAGGGTCAAGGCTGAGGAAG (invA2/F)94°C/5 min; 35 cycles of 94°C/30 s, 55°C/1 min, and 72°C/1 min 30 s; and 72°C/10 min
CTGATCGCACTGAATATCGTAC (invA2/R)
sipA1.126sipACGGCTTCACATTCACAA (sipA/F)94°C/5 min; 35 cycles of 94°C/30 s, 50°C/1 min, and 72°C/1 min 30 s; and 72°C/10 min
CGGGCTCTTTCGTTCA (sipA/R)
1A14fhlA-hilAAACGCTGCGCACGCTTAGCAGCAT (1A/F)94°C/1 min, 30 cycles of 98°C/10 s and 68°C/15 min, and 72°C/10 min
GCCTGGCAGAAAGCTAACAAGCGTGAC (1A/R)
1B3hilA-sicPTTCGTCCAGATGACACTATCTCCTT (1B/F)95°C/5 min; 35 cycles of 94°C/30 s, 55°C/1 min, and 72°C/3 min; and 72°C/7 min
AATTGGGTTTACCGCTCACTTTT (1B/R)
1C4sicP-sipDCTTCATTATTCGCAGCCAGTTCA (1C/F)94°C/1 min, 30 cycles of 98°C/10 s and 68°C/15 min, and 72°C/10 min
TGATGCTGAGATTTGGGATATGGT (1C/R)
1D5sipD-spaSCCCGACTGCCAGGCTTGAT (1D/F)94°C/1 min, 30 cycles of 98°C/10 s and 68°C/15 min, and 72°C/10 min
TTGTAGGTATTGCCGTCATTTGG (1D/R)
1E3spaS-spaOCCGACGGTGGTTAGTGAACATT (1E/F)95°C/5 min; 35 cycles of 94°C/30 s, 55°C/1 min, and 72°C/3 min; and 72°C/7 min
CGTTGCGCTTTGTAATCGGTAG (1E/R)
1F10spaP-invHGTCTCGGTCTCTTCTCCATACTGACG (1F/F)94°C/1 min, 30 cycles of 98°C/10 s and 68°C/15 min, and 72°C/10 min
CTTTCATGGGCAGCAAGTAACGTCTG (1F/R)