TABLE 1.

Primer sequences for PCR of SPI-1 and SPI-2 genes

GeneForward primerReverse primerConditions
invACAGCGATATCCAAATGTTGCAAATGGCAGAACAGCGTCGTA95°C/10 min; 35 cycles of 94°C/30 s, 55°C/1 min, and 72°Ca/2.5 min; and 72°C/10 min
sipAATGGGTACCAGGCGGCTACTAAAATCCATGGAGCTCCAAGCGAGAGAAAAATCTACAC94°C/2 min; 35 cycles of 94°C/30 s, 55°C/1 min, and 68°C/4 min; and 68°Ca/10 min
ssaRGTTCGGATTCATTGCTTCGGTCTCCAGTGACTAACCCTAACCAA95°C/10 min; 35 cycles of 94°C/30 s, 50°C/1 min, and 72°C/2 min; and 72°C/10 min
sifAATGGTCGACATGCCGATTACTATAGGGAATGGATGGGATCCTTATAAAAAACAACATAAACAGCCG95°C/10 min; 35 cycles of 94°C/30 s, 52°C/1 min, and 72°C/1 min; and 72°C/10 min
sopE2TAATACCGCCCTACCCTCAGCATAACACTATCCACCCAGCAC94°C/3 min, 30 cycles of 94°C/1 min, 55°C/1 min, and 72°C/1 min; and 72°C/5 min
fhlA-hilAAACGCTGCGCACGCTTAGCAGCATGCCTGGCAGAAAGCTAACAAGCGTGAC94°C/1 min, 30 cycles of 98°C/10 s and 68°C/15 min, and 72°C/10 min
hilA-spaPTTCGTCCAGATGACACTATCTCCTTCCGTCAGTATGGAGAAGAGACCGAGAC94°C/1 min, 30 cycles of 98°C/10 s and 68°C/15 min, and 72°C/10 min
spaP-invHGTCTCGGTCTCTTCTCCATACTGACGCTTTCATGGGCAGCAAGTAACGTCTG94°C/1 min, 30 cycles of 98°C/10 s and 68°C/15 min, and 72°C/10 min
  • a Conditions at 72°C are for AmpliTaq Gold Taq polymerase from Perkin-Elmer, while the conditions at 68°C are for Elongase enzyme mix from Invitrogen.