TABLE 3.

Oligonucleotides used for this study

OligonucleotideOligonucleotide sequence (5′ → 3′)Nucleotide positionAmplification product size (bp)
S. aureus orfX-specific primer
    Xsau325GGATCAAACGGCCTGCACA 325a
SCCmec-specific primers
    mecii574GTCAAAAATCATGAACCTCATTACTTATG472,b 574c176d or 278e
    meciii519ATTTCATATATGTAATTCCTCCACATCTC 519f223g
    meciv511CAAATATTATCTCGTAATTTACCTTGTTC 511h215i
    mecv492CTCTGCTTTATATTATAAAATTACGGCTG 492j196k
    mecvii512CACTTTTTATTCTTCAAAGATTTGAGC 512l214m
S. aureus orfX-specific probes
    XsauB5-FAMnCCCGCGCGTAGTTACTGCGTTGTAAGACGTCCGCGGGo 346a
    XsauB8-FAMnCCCGCGCATAGTTACTGCGTTGTAAGACGTCCGCGGGo 346p
    XsauB9-FAMnCCCGCGCGTAGTTACTACGTTGTAAGACGTCCGCGGGo 346q
Internal control probe
    PSARM-TETrCCGGCGATGCCTCTTCACATTGCTCCACCTTTCCTCGCCGGo2,038s
Sequencing primers
    IS431626TCTACGGATTTTCGCCATGC 626t1,200u
    Xsau401ATCAAATGATGCGGGTTGTGT 401a
    mecA1059AACAGGTGAATTATTAGCACTTGTAAG1,059v>8,000w
    SA0022Sau2673GAGGACCAAACGACATGAAAATC2,673x
Internal sequencing primers
    meciv1013CAATCGGTATCTGTAAATATCAAAT1,013h
    meciv1411TCGCATACCTGTTTATCTTCTACT1,411h
    meciv916TTGGTTCCATCTGAACTTTGAG 916h
    mecvii1126ACTAGAATCTCCAAATGAATCCAGT1,126l
    mecv1029TTTAAATTCAGCTATATGGGGAGA1,029j
    mecv968TTCCGTTTTGCTATTCCATAAT 968j
    tetK1169CCTCTGATAAAAAACTTGTGAAAT1,169y
    tetK136ACTACTCCTGGAATTACAAACTGG 136y
    Xsau193GCCAAAATTAAACCACAATCCAC 193a
    Xsau367CATTTTGCTGAATGATAGTGCGTA 367a
  • a Nucleotide position in orfX (start codon = nt 1 to 3) from GenBank accession no. AP003129.

  • b Nucleotide position in SCCmec from the orfX gene (start codon = nt 1 to 3) from GenBank accession no. AB033763.

  • c Nucleotide position in SCCmec from the orfX gene (start codon = nt 1 to 3) from GenBank accession no. AP003129.

  • d Amplification product size generated with primer Xsau325 using DNA from MRSA with MREJ type i.

  • e Amplification product size generated with primer Xsau325 using DNA from MRSA with MREJ type ii.

  • f Nucleotide position in SCCmec from the orfX gene (start codon = nt 1 to 3) from GenBank accession no. AB037671.

  • g Amplification product size generated with primer Xsau325 using DNA from MRSA with MREJ type iii.

  • h Nucleotide position in the SCCmec from the orfX gene (start codon = nt 1 to 3) from GenBank accession no. AY267374.

  • i Amplification product size generated with primer Xsau325 using DNA from MRSA with MREJ type iv.

  • j Nucleotide position in the SCCmec from the orfX gene (start codon = nt 1 to 3) from GenBank accession no. AY267381.

  • k Amplification product size generated with primer Xsau325 using DNA from MRSA with MREJ type v.

  • l Nucleotide position in the SCCmec from the orfX gene (start codon = nt 1 to 3) from GenBank accession no. AY267375.

  • m Amplification product size generated with primer Xsau325 using DNA from MRSA with MREJ type vii.

  • n FAM, 6-carboxylfluorescein.

  • o The underlined sequences constitute the stem of each molecular beacon.

  • p Nucleotide position in orfX (start codon = nt 1 to 3) from GenBank accession no. AB037671.

  • q Nucleotide position in orfX (start codon = nt 1 to 3) from GenBank accession no. AP004822.

  • r TET, tetrachloro-6-carboxylfluorescein.

  • s Nucleotide position from GenBank accession no. D83207.

  • t Nucleotide position in the IS431 transposase gene (start codon = nt 1 to 3) from GenBank accession no. AB037671.

  • u Amplification product size generated with primer Xsau401.

  • v Nucleotide position in mecA (start codon = nt 1 to 3) from GenBank accession no. X52593 (35).

  • w Amplification product size generated with primer Xsau401 or SA0022Sau2673.

  • x Nucleotide position from the SA0022 orf (start codon = nt 1 to 3) from GenBank accession no. AP003129.

  • y Nucleotide position in tetK (start codon = nt 1 to 3) from GenBank accession no. S67449.