TABLE 1.

Primers used for cloning of antigens

AntigenSense primer (5′→3′)Antisense primer (3′→5′)Length (amino acids) of antigen (positions)
MET6-15′-GACGACGACAAGATGGTTCAATCTTCCGTCTTAGGT5′-GAGGAGAAGCCCGGTTAAGAAGATTCGGATCTAGC400 (1-400)
MET6-25′-GACGACGACAAGATGATACCAACGATCCAAAG5′-GAGGAGAAGCCCGGTTAGTATTTAGCTCTGAATTC367 (401-768)
NOT55′-GACGACGACAAGATGACTCATGCACCAGCAGCAGTGT5′-GAGGAGAAGCCCGGTTAAACAATTCGAGAAATGGTATCAC71 (401-474)
SET15′-GACGACGACAAGATGTCATACAATAACAGAAGCGGA5′-GAGGAGAAGCCCGGTTATTGAGGTAATTGCTTATATGG208 (1-208)
RBT45′-GACGACGACAAGATGAAGTTTTCTCAAGTTGCCACTACTGCTGCTGCCATT5′-GAGGAGAAGCCCGGTAATAACACCAGAGTTCTGTAAAAGTCGGTA359 (entire gene)
IPF91625′-GACGACGACAAGATGAAAAAAAGGTTAGTTTTGTTTGATGATTCTGATGAT5′-GAGGAGAAGCCCGGTAATTTATCAATTTACATATAGTGCTCAAAATGGACCTGTCAA272 (entire gene)
CAR15′-GACGACGACAAGATGTCATCAATTCAATATAAATATCATCCAGACAA5′-GAGGAGAAGCCCGGTAATGTTATTTCAAACTGGGTTACGTGTAGAT318 (entire gene)
GAP15′-GACGACGACAAGATGGCTATTAAAATTGGTATTAAC5′-GAGGAGAAGCCCGGTTAAGCAGAAGCTTTAGCAAC336 (entire gene)
ENO15′-GACGACGACAAGATGTCTTACGCCACTAAAATCCAC5′-GAGGAGAAGCCCGGTTACAATTGAGAAGCCTTTTGGAA441 (entire gene)
BGL25′-GACGACGACAAGATGCAAATCAAATTCTTGACTACT5′-GAGGAGAAGCCCGGTTAGTTGAATTTACAGTCAATTGA309 (entire gene)
FBA15′-GACGACGACAAGATGGCTCCTCCAGCAGTTTTAAGT5′-GAGGAGAAGCCCGGTTACAATTGTCCTTTGGTGTGGAA360 (entire gene)
MUC1-15′-GACGACGACAAGATGTCATTTTGGGACAACAACAA5′-GAGGAGAAGCCCGGTTAGGTTGAGTTATTGGTTAAAA306 (1-306)
MUC1-25′-GACGACGACAAGATGGAGTATATCGCATCTTGGTGT5′-GAGGAGAAGCCCGGTTATTCATGTGGCATTGCTCGATA153 (735-888)
PGK1-15′-GACGACGACAAGATGTCATTATCTAACAAATTATCA5′-GAGGAGAAGCCCGGTTAACCACCACCAACAATC238 (1-238)
PGK1-25′-GACGACGACAAGATGGCCTTCACTTTCAAGAAA5′-GAGGAGAAGCCCGGTTAGTTTTTGTTGGAAAGAGC180 (239-438)