TABLE 1.

Amplification and sequencing primers for adk, gyrB, and purAa

GenePrimer sequence (5′→3′)
adk ATTCTGCTTGGCGCTCCGGG
CCGTCAACTTTCGCGTATTT
gyrB TCGGCGACACGGATGACGGC
ATCAGGCCTTCACGCGCATC
purA CGCGCTGATGAAAGAGATGA
CATACGGTAAGCCACGCAGA
  • a The primers for the remaining seven genes (gnd, glnA, aroE, arcA, mdh, tem, and shv) have previously been published as cited in the text.