TABLE 1.

Sequences of oligonucleotide probes used in the C. diphtheriae spoligotyping assay

DRB spacerProbe sequence (5′-amino labeled)Probe concn (pmol/slot)
1GGTGAGTAAAACTCCGAAAGTTACCG10
2GGAAATGTTTCTTAAACTCCCCACCA10
3TACCGTGGCGAACCAGTGC10
4CCGATGTGACCGCAGCAC80
5TCATATCCCTGAAATAAACTGTTCCAGTG10
6AGTACCGGTCTGCCATGAGG10
7GGTGGATAATAGGCTAGGTGATTCTTGG10
8AGGCGATCGCCGGTTCTAT150
9GCTCCACAGGGCCAAAAGTTC30
10GCCGCTGGAGGAGCTTACTC80
11TTTGGTTGTGCAGTCCCCGAA10
12GCGGCCTTGTGCAGGTCA10
13GAAATCGCTGAACGCCGACTC30
14ATGTCCCAAAGCTAAGGTAGCGG30
15GCTTGTCGGGCCGCATATG30
16GAGGATTCGACGGGTTTCCATTG30
17CTTGTGAGGGTCCTCGGATGAC80
18GCACCATCCACGGGTGTTATTTG30
19CTCAGATTGCGGGGATTCTCCC80
20AAAGCGAGGTCGCTGCGC80
21CATGCCATCAGACCCGACC30
22GTCCTCACCCTCGTAGGACCA150