TABLE 3.

Primers used for multiplex PCR identification of the most frequent Salmonella first-phase flagellar antigens

PrimerSequence (5′-3′)5′ position in fliC geneaReference or source
Sense-60GCAGATCAACTCTCAGACCCTGGG481-50417
Antisense-iATAGCCATCTTTACCAGTTCC714-734This work
Antisense-z10CGTCGCAGCTTCTGCAACC911-929This work
Antisense-bCGCACCAGTCYWACCTAAGGCGG628-650This work
Antisense-ehAACGAAAGCGTAGCAGACAAG658-678This work
Antisense-lvCCTGTCACTTTCGTGGTTAT790-809This work
Antisense-rAAGTGACTTTTCCATCGGCTG741-761This work
Forward-dCCCGAAAGAAACTGCTGTAACCG539-561This work
Reverse-dTGGATATCAGTATTGCTCTGGGC625-647This work
Forward-GGTGATCTGAAATCCAGCTTCAAG547-569This work
Reverse-GAAGTTTCGCACTCTCGTTTTTGG1055-1078This work
Forward-Sdf-lTGTGTTTTATCTGATGCAAGAGG1
Reverse-Sdf-lCGTTCTTCTGGTACTTACGATGAC1
  • a Dashes indicate that primers do not target the fliC gene.