TABLE 1.

Genetic polymorphism of the seven housekeeping genes analyzed by MLST

GenePCR and sequencing primersSize (bp) of analyzed fragmentsNo. of allelesNo. of polymorphic sites% Polymorphic sitesNo. (%) of nucleotide differences between allelesMean % G + C contentdN/dSa
OrientationSequence (5′→3′)
aroEForwardCTAGTAGGTGAAAAACTCTCTCA41010327.81-23 (0.3-6.7)29.710.0682
ReverseACTGGTGTAGCATTTAATATTATATC
ddlForwardCATAAACTTGTTCATTCAGAAGG424530.71-3 (0.2-0.7)30.320.1654
ReverseCTATGAGAAGTAAAGCCAGGAAT
dutAForwardCCTAATTTTGCTCACAAAGGT3255144.31-11 (0.4-3.4)34.780.1125
ReverseAAATCCAGTTGAGCCAAACC
gmkForwardTCA GGT GCA GGA AAA GGT AC2927113.71-8 (0.4-2.8)32.120.1074
ReverseTCT GTT TCT GTA CCT CTT CCA AC
recAForwardCCA GAT ACA GGT GAA CAG GC37911174.51-13 (0.3-3.5)32.780.0000
ReverseTTT AAC ATT TTC TCT TCC TTG TCC
sodAForwardTATSCWTATGATGCWYTWGARCC4167163.81-14 (0.3-3.4)30.980.0813
ReverseTARTAAGCATGYTCCCAAACATC
tpiForwardGCAGGAAACTGGAAAATGCATAA3957102.51-7 (0.3-1.8)29.360.2611
ReverseCAGATTGGCTCATATGCAACAAC
  • a Ratio of nonsynonymous to synonymous substitutions.