TABLE 3.

Sequences of the padlock probes used in this study

Probea5′ endCommon sequencebAllele tagcLocus tag3′ end
Probes targeting SNPs at MLST loci
    tpi-243-AGCATCTTCAGATGTTGATC1A2ATTTGATCGTAACTCGGGTGAAATGCACACATTTCATTT
    tpi-243-GGCATCTTCAGATGTTGATC1A1ATTTGATCGTAACTCGGGTGAAATGCACACATTTCATTC
    yqiL-333-CAAGCGACTGTTGTTGAC1A1TTTAGTCGTTTGCCCGAGGCGTCCCATTTTAAAACCG
    yqiL-333-TAAGCGACTGTTGTTGAC1A2TTTAGTCGTTTGCCCGAGGCTGTCCCATTTTAAAACCA
    gmk-129-TATTAAAGCTTCAAACGCAC1A2CTTAACTATTAGCGTCGGTGATTCTATAAATTGGTCATCTTTA
    gmk-129-CATTAAAGCTTCAAACGCAC1A1CTTAACTATTAGCGTCGGTGTCTATAAATTGGTCATCTTTG
    arcC-162-TACGATTGTGCCTACAGC1A1CTATATCCTTACCGCGTATGCTACTTCCACACGTGTA
    arcC-162-AACGATTGTGCCTACAGC1A2CTATATCCTTACCGCGTATGCTACTTCCACACGTGTT
    arcC-210-TGTTGGGTTATTGAATCGTC1A2GAGTAGCCTTCCCGAGCATTAAAAGGACCAATTGGTTTA
    arcC-210-CGTTGGGTTATTGAATCGTC1A1GAGTAGCCTTCCCGAGCATTAAAGGACCAATTGGTTTG
    aroE-132-ATCTTTATGAGGAATTGTGATC1A2AACAACGATGAGACCGGGCTTAAATACGGTATGATACGT
    aroE-132-GTCTTTATGAGGAATTGTGATC1A1AACAACGATGAGACCGGGCTAAATACGGTATGATACGC
    gmk-318-TTCTAAACTTGGAGGTGCC1A2AATACGCTGAATAGAGCCCTTCGCTCTCTCAAGTGA
    gmk-318-ATCTAAACTTGGAGGTGCC1A1AATACGCTGAATAGAGCCCTTCGCTCTCTCAAGTGT
    pta-294-CCCTGTTGAATGTGCTGC1A1ACATATCCTAATACAGGCGCGGACGCACAGTGTCG
    pta-294-ACCTGTTGAATGTGCTGC1A2ACATATCCTAATACAGGCGCGGACGCACAGTGTCT
    tpi-36-TTGCGCTTTTTTGTTAATTTC1A2GACGATCCTTATACTCGATGCCATGTTTGAAAATAGCA
    tpi-36-CTGCGCTTTTTTGTTAATTTC1A1GACGATCCTTATACTCGATGCATGTTTGAAAATAGCG
    pta-383-TCATCACCTTTAATCATAAAGC1A2GAAGACAGTTATACCCATGCTCACCAAAGATGTATTGTA
    pta-383-ACATCACCTTTAATCATAAAGC1A1GAAGACAGTTATACCCATGCCACCAAAGATGTATTGTT
    tpi-153-CCCTGCAACAGCTTTCTC1A1TGTCTACCTTTCCGTCAAGATTTAAGTTGATCTTCAGATAAG
    tpi-153-TCCTGCAACAGCTTTCTC1A2TGTCTACCTTTCCGTCAAGATTTAAGTTGATCTTCAGATAAA
    tpi-087-ATCTGTTTCACCAACACAC1A1AAACCATCGACTCACGGGATCACTTTCACGCTCTTCT
    tpi-087-CTCTGTTTCACCAACACAC1A2AAACCATCGACTCACGGGATACTTTCACGCTCTTCG
    yqiL-505-TTACTGCTTTATGTTGTGAGC1A1ATTGACCAAACTGCGGTGCGCATTTTGCTGTGCACA
    yqiL-505-CTACTGCTTTATGTTGTGAGC1A2ATTGACCAAACTGCGGTGCGCATTTTGCTGTGCACG
Probes targeting genes within SCCmec (recombinase genes and mecA)
    ccrB-IAATTTTTGACTTCCATACGC1A1ATAAAGCTCTATACTCCGCGGCATTAACTTGCCTGTTG
    ccrB-IIITTGTATTGACTTCCATACGC1A2ATAAAGCTCTATACTCCGCGGCATCAATTTACCACTGC
    ccrB-IITCATGTTTACTATTAGGTATTTC1A1AACTAGCATCTAAGCACTCGCATGTTGATTAATCATCAGT
    ccrB-IVTCGTGTTTACTATCTGGTAC1A2AACTAGCATCTAAGCACTCGCATGTTGGTTAATCATTAGC
    ccrC-VACTTTTACCACTTCTTCGC1A1GCTCTAATGTTAAGTGCTCGCCAATATCACATCATTTTTATC
    ccrB-VITACTTTATCATAGCCTAGAGC1A2GCTCTAATGTTAAGTGCTCGAGCTCTTTTTTACTATCAGG
    mecAATGAAGGTGTGCTTACAC1A2ACCACAGATCGAAGGTCGGACATAAATGGATAGACGTCAT
Probes targeting staphylococcal 16S rRNA gene
    rDNA-Cy5CGTAGGAGTCTGGACCC1A1AAGGCACGTATCATATCCCTCCTACTGCTGCCTCC
    rDNA-Cy3CGTAGGAGTCTGGACCC1A2AAGGCACGTATCATATCCCTCCTACTGCTGCCTCC
  • a Probe names are composed of gene names, SNP positions within genes, and alleles.

  • b Common sequence C1, AGAGTGTACCGACCTCAGTA.

  • c Allele tag A1, GCCGTGACTATCGA; allele tag A2, CATGAATCCGTAGT.