TABLE 3.

Primers

PrimerSequenceaPosition
AN345GTAACASWWGCCTCTGGGSCCAAAAG421-446b
AN344GGCCCCWGRTCAGATCCAYAGT615-594b
AN257cCCTRYGGGTACCTYCWGGGCATCCTTC556-582b
AN287dAATTAACCCTCACTAAAGGGAGAGATCAACCCTATGCCTG140-156b
AN288GAAATCTGGTGAAAAGGGCAT994-974b
AN289dAATTAACCCTCACTAAAGGGAGATATCCCATACTAGACTGG118-135d
AN290AGTGCCATGTGCCAAGTGAAC1002-982d
  • a Ambiguity codes: R, A or G; Y, C or T; W, A or T; and S, C or G. Phage T3 RNA polymerase promoter is underlined.

  • b Positions are relative to the genome of HPeV1-Harris (GenBank accession number S45208).

  • c AN257 is labeled at the 5′ end with Yakima Yellow (Epoch Biosciences, Bothell, WA) and at the 3′ end with Black Hole Quencher 1 (Biosearch Technologies, Novato, CA).

  • d Positions are relative to the genome of LV-SWE87-012 (GenBank accession number AF327920).