TABLE 2.

List of probe sequences used for Trichosporon species-specific and group-specific identification

ProberDNA regionSpecificityProbe Sequence (5′-3′)Concn (nM)
P1D1/D2 T. brassicae ATAGCCTAGTATCACATACAC 0.1
P2D1/D2 T. montevideense/T. domesticum ATAGCCTAGGTTCACATACAC 0.1
P3cIGS T. scarabeorum ATTGGCCATATTCCTACTTGC 0.4
P4D1/D2 T. monoliiforme TATTATTGCATGCACTGGGTG 0.1
P5D1/D2 T. jirovecil/T. cutaneum CAGTCGTGTTCTTCAGATTCA 0.1
P6ITS T. laibachii/T. multisporum TGGCTCCTCTCAAAAGAGTTA 0.1
P7bIGS T. multisporum AGTTCGTACAAGTTCGTGGAT 0.2
P8D1/D2 T. gracile GGATAAAGATGCTAGGAATGT 0.1
P9D1/D2 T. veenhuisii TTGTCCGGTAGATAAAGGCAG 0.1
P10D1/D2 T. loubieri TCAGTTTTGCCCGGTGGATAA 0.2
P11ITS T. mucoides ACTTCGGTCGATTACTTTTAC 0.2
P11bIGS T. mucoides AACGTGCTGCGCTACTAGGTG 0.4
P12ITS T. cutaneum TCGCTGGTGTTGACTTGAGAA 0.1
P12bIGS T. cutaneum CAGTGACATGTGGGCGTTATA 0.2
P13ITS T. ovoides GTTTCACTGGTTCCATTGTGT 0.1
P14ITS T. inkin CTGGGTCCATGGTGTTGAAGC 0.1
P15D1/D2 T. asteroides/T. japonicum/T. asahii TACTTCCTTGGAACGGGTCAA 0.1
P16bIGS T. japonicum GAGCAGCGAGCGACTTGGCAG 0.2
P17D1/D2 T. faecale ACTGCAGCTCACCTTTATGGC 0.2
P18bIGS T. aquatile CTTAACACGATAACCGGTGCT 0.2
P19D1/D2 T. caseorum TTATAGCCTGTTATCACATAC 0.4
P20D1/D2 T. guehoe AGGTAGTTTCAATGTAGCTTC 0.2
P21bD1/D2 T. porosum CATGAATCATGTTTATTGGACTC 0.1
P22ITSOvoides cluster CTGATCGCTCGCCTTAAAAGA 0.1
P23bITS T. smithiae TGGATTTGAGTGATGGCAGTT 0.2
P24ITS T. debeurmannianum TTTTTACTTCGATCTCAAATC 0.1
P25bITS T. sporotrichoides CACTCTGTGTCGATTTTACAA 0.2
P25cIGS T. sporotrichoides AGTTCATGCTCTAAGTCGGTTC 0.2
P26D1/D2 T. dehoogii CCTATTGTCGTATACACTGGA 0.1
P27bITSCutaneum cluster CGGACAATTCTTGAACTCTGGT 0.2
P28bIGS T. jirovecii TGTGAGTCTATCGGGCGCTTG 0.2
P29ITS T. lignicola TGTCCTCTGGAGTAATAAGTT 0.1
P30ITSPorosum cluster TGAACGTCTAGTTATTATAACAA 0.2
P31D1/D2 T. gamsii ATAAAGGTAATAGGAAGGTGG 0.2
P32D1/D2 T. laibachii/T. multisporum/T. dulcitum/T. gracile CAGTCGTGTTTATTGGATTCA 0.2
P33ITSGracile cluster TGAACGTCATTAGATCATAA 0.1
P34bIGS Cryptococcus curvatus GGTTTAAGATTGTATTGACTG 0.2
P35IGS T. dulcitum AACGTACAAGTCCGGACATGA 0.2
P36IGS T. dermatis ACGGTAGTTTGGAGTGAAGTGC 0.2
P37IGS T. asteroides/T. japonicum GAGCAGCGAGCGACTTGGCAG 0.2
P38IGS T. asahii TTCTCGACTGATGGCCTTGGT 0.2
P39IGS T. montevideense GGGTCCTAATAGATGCCATGT 0.2
P41bIGS T. coremiiforme CACAGAGGTGCAAGAGGTGGG 0.2
P42IGS T. lactis GCTTCGGAGACTTGGGTTTGC 0.4
P43ITS T. inkin/T. ovoides ACTGTTCTACCACTTGACGCA 0.4
P44bD1/D2 T. vadense TTATCACATGCACTGGGGGAG 0.4
P46IGS T. domesticum GCATGAGTGACGGCAGAGGTG 0.4
P47IGS T. laibachii GTGCACAAGAAACATACTAAC 0.2