TABLE 1.

Nucleotide sequences of primer sets used in this study

Gene targetPrimer sequence (5′-3′)aProduct size (bp)Serovar specificitybProtein encoded by the target gene
lmo0737 For: AGGGCTTCAAGGACTTACCC691 L. monocytogenes serovars 1/2a, 1/2c, 3a, and 3cUnknown, no similarity
Rev: ACGATTTCTGCTTGCCATTC
lmo1118 For: AGGGGTCTTAAATCCTGGAA906 L. monocytogenes serovars 1/2c and 3cUnknown, no similarity
Rev: CGGCTTGTTCGGCATACTTA
ORF2819For: AGCAAAATGCCAAAACTCGT471 L. monocytogenes serovars 1/2b, 3b, 4b, 4d, and 4ePutative transcriptional regulator
Rev: CATCACTAAAGCCTCCCATTG
ORF2110For: AGTGGACAATTGATTGGTGAA597 L. monocytogenes serovars 4b, 4d, and 4ePutative secreted protein
Rev: CATCCATCCCTTACTTTGGAC
prs For: GCTGAAGAGATTGCGAAAGAAG370All Listeria speciesPutative phosphoribosyl pyrophosphate synthetase
Rev: CAAAGAAACCTTGGATTTGCGG
  • a For, forward; Rev, reverse.

  • b For the specificity of lmo1118 gene fragment amplification within L. monocytogenes strains of serovar 1/2c or 3c, we note the exception of the serovar 1/2a EGDe strain in which the gene was first identified.