TABLE 1.

Nucleotide sequences of serotype-specific capture and detection probesa

SerovarCapture probeDetection probeORFReference(s)
1/2a(3a)TAGCAGCACCTgTAGCAGTTTGATCTAGTAATTTGATGTTGTTGTAGTTATTTTTCGFlaA2, 6, 16
1/2c(3c)TAGCAGCACCTaTAGCAGTTTGATCTAGTAATTTGATGTTGTTGTAGTTATTTTTCGFlaA2, 6, 16
1/2b(3b)CAAGTATTAGGAGTTATAAGGGGATTATTAATACAATCTGGCTTTATGGATTTTTCGSerotype-specific gene cassette11
Div I 4bCATCCCTTACTTTGGACGTGTCGTAATTTATCCCTTTTTGTTTGCTTACATTTTTCGORF21107
  • a The single base difference that confers serotype specificity on the 1/2a(3a) and 1/2c(3c) capture probes is shown in lowercase. The seven additional nucleotides on the 3′ end of each detection probe (underlined) serve as a bridging sequence and are required for ligation of the detection probe to the dendrimer arms. ORF, open reading frame.