TABLE 1.

Reference strains, primer sequences, and multiplex PCR panel assignment for ETEC toxins and colonization factors

StrainaPCR panelVirulence factorProduct size (bp)Primer sequenceReference or source
Forward (5′-3′)Reverse (5′-3′)
286 C2ToxinLT273ACGGCGTTACTATCCTCTCTGGTCTCGGTCAGATATGTG11
VX 67356ToxinSTp166TCTTTCCCCTCTTTTAGTCAGACAGGCAGGATTACAACAAAG1
ST 64111ToxinSTh120TTCACCTTTCCCTCAGGATGCTATTCATGCTTTCAGGACCAThis study
60R936ICS1243TCCGTTCGGCTAAGTCAGTTCCGCACATTTCCTGTGTTCT11
E11881/9ICS4198ACCTGCGGCAAGTCGTTTTCTGCAGGTTCAAAAGTCACA11
E 29101AICS7154CGCCGGTTACACGTAGTGATCCATTTAAAGTGATTGCGACTT11
350C1AICS12137CCAGTCTATGCCAGGTTGCTTGTGGGGTCACAGTTTACCA11
E19446ICS3100CTAGCTTTGCCACCACCATTGGCAACTGACTCCCATTTGT11
E 9034AIICS21617TCATGAGCCTGCTGGAAGTTATCATCCGGCTACCTAAAGTAATTGAGT4
58R957IICS2368AGTGGTGGCAGCGAAACTATTTCCTCTGTGGGTTCTCAGGThis study
E17018/AIICS5226TCCGCTCCCGTTACTCAGGAAAAGCGTTCACACTGTTTATATT11
258909-3IICFA/I170GCTTATTCTCCCGCATCAAAACTTGTCCTCCCCATGACAC11
E20738AIICS17130GGAGACGCTGAATACAACTGACTCAGGCGCAGTTCCTTGT11
E 20738A, CS19IIICS17/19195CGGTGCGTTTAACACAGCTATCGATACACTCGCATTCGTT11
E34420AIIICS8166ATCCGGATTATCAAGCTCCAGAAGATGTTATTGCACCACCAA11
E11881/14IIICS6152CTGTGAATCCAGTTTCGGGTCAGGAACTTCCGGAGTGGTA11
8786IIICS15130CGAAATTGGACAAGCGATGTCCAGCAGGGATATTATTCG11
CS20 Ws 7179AIIICS20114AGGTATCCAAATCCGCACTGCATCAGCCAGCACATAGGAA11
CS18IVCS18362ATCCGTCAGGTGTTTGTGGTCACCTGAATTCCTCGACAGGThis study
PCFO9IVCS13178GGGACTGCCACAATGAATTTCAGCACCACCTGCTGATTTA11
E7476AIVCS14162TTTGCAACCGACATCTACCACCGGATGTAGTTGCTCCAAT11
ARG-3IVCS22127ATTGGACAAGCGTCCAACACTTCCAGCAGGGATATTATCATTTT11
  • a All strains belong to the reference strain collection at Department of Microbiology and Immunology, Institute of Biomedicine, University of Gothenburg, Göteborg, Sweden.