TABLE 1.

Details of PCR primers and appropriate combination of factors to generate gene-specific amplicons

Gene targetaPrimer sequence (5′-3′)Annealing temp (°C)Amplicon size (bp)Reference
ForwardReverse
ctxACTCAGACGGGATTTGTTAGGCACGTCTATCTCTGTAGCCCCTATTACG6030132
cepGCTACATGTTTAGCTCACTGTTTAGCCTTACGAATTAAGCC602515
rstRClCTTCTCATCAGCAAAGCCTCCATCTCGAGTTGTAATTCATCAAGAGTG554745
rstRElGCACCATGATTTAAGATGCTCTCGAGTTGTAATTCATCAAGAGTG555015
rstRCalCTGTAAATCTCTTCAATCCTAGGTCGAGTTGTAATTCATCAAGAGTG553135
rstREnvGTTAACGCTTCAAGCCTGTCGAGTTGTAATTCATCAAGAGTG5540044
tcpAClCACGATAAGAAAACCGGTCAAGAGACCAAATGCAACGCCGAATGGAGC6061832
tcpAETGAAGAAGTTTGTAAAAGAAGAACACGAAAGGACCTTCTTTCACGTTG6047232
rtxAGCGATTCTCAAAGAGATGCCACTCATTCCGATAACCAC53.81,36637
hlyAAGATCAACTACGATCAAGCCAGAGGTTGCTATGCTTTCTAC54.21,67747
toxTACTGTCGACGCAAAGCATATTCAGAGACGCGGATCCATACAATCGAAAATAGGA651,1017
ctxBGGTTGCTTCTCATCATCGAACCACGATACACATAATAGAATTAAGGAT5546046
O1 wbGTTTCACTGAACAGATGGGGGTCATCTGTAAGTACAAC5519225
O139 wbfAGCCTCTTTATTACGGGTGGGTCAAACCCGATCGTAAAGG5544925
ompWCTCAGACGGGATTTGTTAGGCACGTCTATCTCTGTAGCCCCTATTACG6458841
NAG-STCCTATTCATTAGCATAATGCCAAAGCAAGCTGGATTGC5521545
VSP-I (VC0178)AGGAGGCGTGTAAGTCATAGCAGACCACGAATACCTGCTCC551,11047
VSP-I (VC0185)AGAGGCTTGTTTACTATCAGATCGGTACTGTCAGGGCT502,05347
VSP-IIGTTTTCTGCGTTGTTCGAGTCCTGATGTCTCTCTTGCCG5296547
TTSS (vcsC2)GGAAAGATCTATGCGTCGACGTTACCGATGCTATGGGTCATATGGAATTCCCGGGATCCATGCTCTAGAAGTCGGTTGTTTCGGTAA60535This study
TTSS (vcsN2)GGATCCCGGGAATTCCATATGCGTCGACAGTTGAGCCAATTCCATTCGGGGTACCATGCTCTAGACGACCAAACGAGATAATG55484This study
TTSS (vspD)ATCGTCTAGAACTCGAAGAGCAGAAAAAAGCATCGGTCGACCTTCCCGCTTTTGATGAAATG5542218
TTSS (vcsV2)ATGCAGATCTTTTGGCTCACTTGATGGGATGCGTCGACGCCACATCATTGCTTGCT5574218
IS1004ATTGTCATCCCTAAACCACCAGGCGGTTTTAATATAAGCC60603This study
  • a rstRCl and tcpACl, rstR gene and tcpA gene of the classical type; rstREl, rstR gene of El Tor biotype; rstRCal, rstR gene of Calcutta biotype; rstREnv, rstR gene of environmental strain VCE232; tcpAET, tcpA gene of El Tor biotype; NAG-ST, nonagglutinable V. cholerae heat-stable enterotoxin.