TABLE 1.

Oligonucleotides used for MLSTa

Oligonucleotide use and nameSequence (5′ to 3′)
Amplification
    abcZ-fN1gttttcccagtcacgacgttgta CCGGTTTGCAAAAGCTCGACGAC
    abcZ-rN2ttgtgagcggataacaatttc TTGTCAAAGAGGCGGTTGTGTTCC
    adk-fN1gttttcccagtcacgacgttgtaGCACTCAGGCGCAATTCATCACC
    adk-rN2ttgtgagcggataacaatttc TTTGCCCAATGCGCCCAATACTTC
    aroE-fN1gttttcccagtcacgacgttgtaCTGGCGGACGAGCATTCCGAACGC
    aroE-rN2ttgtgagcggataacaatttc GCGGTAATCCAGTGCGACATCGCG
    fumC-fN1gttttcccagtcacgacgttgtaCGTCTGAACGATGCGCTTAAAGAC
    fumC-rN2ttgtgagcggataacaatttcTCGGCAGGAACGACCAGTTCGTC
    gdh-fN1gttttcccagtcacgacgttgtaGAAGGGCAAATTTACCGCATCGAC
    gdh-rN2ttgtgagcggataacaatttcCCAAATCGGTTGCCAGCGGCACGG
    pdhC-fN1gttttcccagtcacgacgttgtaTGCCGGCCGTACGACGCTGAACGG
    pdhC-rN2ttgtgagcggataacaatttcGCGTTTCCAGCTAGGAGCTGAATC
    pgm-fN1gttttcccagtcacgacgttgtaCCTGCAAGATTTGATTGCCGCGCT
    pgm-rN2ttgtgagcggataacaatttcACGCATCAGACCGAAGCCGTCGGG
Sequencing
    Universal forwardgttttcccagtcacgacgttgta
    Universal reversettgtgagcggataacaatttc
  • a The sequences of upstream and downstream oligonucleotides (for amplification) of each gene (series N1 and N2, respectively) are given as uppercase letters. Universal forward and reverse oligonucleotides were added as adaptors in front of each oligonucleotide and are given as lowercase letters. Universal forward and reverse oligonucleotides were used for sequencing.