TABLE 2.

Primer sequences for DNA sequencing

GeneForward primerReverse primer
ahpC a AGCAGTGGCATGACTCTCCGGCCGGCTAGCACCTCT
inhA CGAGCGTAACCCCAGTGCGAAAGTCCCCGGTGAGGTTGGCGTTGAT
katG TCGGCGGTCACACTTTCGGTAAGAGCGACGCGTGATCCGCTCATAG
ndh AGAAGCTGGGCGTGGAAATCGGGTACCCGGGAATGGACA
rpoB b CGACCACTTCGGCAACCGTCGATCGGGCACATCCGG
  • a The primers were designed by Piatek et al. (14).

  • b The primers were designed by Kim et al. (9).