TABLE 2.

Primer sequences used in this studya

PrimerSequenceReference(s)
Ch1FGACCACTCAGGCCGCTGAAAT 6
Ch1RCCGCGCTCAAGTGGTTATCGG 6
Ch2FAACAACAGGTTGCAAGAGAGCATT 6
Ch2RTATTGCTTTTTTAATGGCCGTT 6
rstRclaFTTTGCTACTTCTTCTTGGTT 11
rstRETFTGAGCATAAGCTCTTGATTT 6, 11
rstARCCGTGAAAGTCATCAACG 6
rstCFGATGTTTACGATAGCCTAGAAGACTT 6
rstCRTACAGTGATGGCTCAGTCAATGC 6
rstCF4AAATCCGCAACTCAAGGCATTGA 6
rstCR4TAAGCGCCTGAACGCAGATATAAAG 6
ctxBFAGATATTTTCGTATACAGAATCTCTAG 6
cepRAAACAGCAAGAAAACCCCGAGT 6
rstRCalFTCAAGCTTTTTTTTGCTTTATCTTA 2, 11
rstRCalRTGGCAACAAAGCACATTAAAGA 2, 11
rstREnvFGCTTCATTTGTGTATTGGTCTATTAGGTAGTTA 11
rstREnvRTCGAGTTGTAATTCATCAAGAGTGAAAA 11
  • a Primers were designed in this study based on the sequences described in the references.