TABLE 1.

PCR primers for detection of different antibiotic resistance genes

PrimerNucleotide sequence (5′ to 3′)aPCR product size (bp)MgCl2 concn (mM)Annealing temp (°C)GenBank accession no. or reference
Int 1FF: CCTCCCGCACGATGATC280255 22
Int 1RR: TCCACGCATCGTCAGGC
Int 2FF: TTATTGCTGGGATTAGGC233350 22
Int 2RR: ACGGCTACCCTCTGTTATC
5′-CSF: GGCATCCAAGCAGCAAGCVariable355 U12338
3′-CSR: AAGCAGACTTGACCTGAT
Hep 74F: CGGGATCCCGGACGGCATGCACGATTTGTAVariable355 23
Hep 51R: GATGCCATCGCAAGTACGAG
BlaTEMFF: GTTGGGTGCACGAGTGGGTTACATC559252 SFU48775
BlaTEMRR: AAGGGCCGAGCGCAGAAGTGGTC
BlaOXAFF: ACTGTCGCATCTCCATTATTTGA713352 AJ238349
BlaOXARR: ACTGCATTTTTCTTGGCTTTTAT
CatFF: AACGACCCTGCCCTGAACCG1,003358 U81140
CatRR: TTGCGCCGAATAAATACCTG
Sul 1FF: CGGCGTGGGCTACCTGAACG433369 AF071413
Sul 1RR: GCCGATCGCGTGAAGTTCCG
Sul 2FF: GCGCTCAAGGCAGATGGCATT293369 M36657
Sul 2RR: GCGTTTGATACCGGCACCCGT
Tet A FF: GGCCTCAATTTCCTGACG372359 X0006
Tet A RR: AAGCAGGATGTAGCCTGTGC
Tet B FF: GAGACGCAATCGAATTCGG228361 J01830
Tet B RR: TTTAGTGGCTATTCTTCCTGCC
Tet C2 FF: TGCTCAACGGCCTCAACC379363 J01749
Tet C2 RR: AGCAAGACGTAGCCCAGCG
Tet C3 FF: TCCTTGCATGCACCATTCC635363 J01749
Tet C3 RR: AACCCGTTCCATGTGCTCG
Tet D FF: GGATATCTCACCGCATCTGC436361 X65876
Tet D RR: CATCCATCCGGAAGTGATAGC
DhfrIa FF: GGAGTGCCAAAGGTGAACAGC367350 X00926
Dhfr Ia RR: GAGGCGAAGTCTTGGGTAAAAAC
  • a F, forward; R, reverse.