TABLE 1.

List of primers used in this study

Objective of primer constructionPrimer nameNucleotide sequence (5′-3′)Size (bp) of PCR productGene or structure on which primer was designedPVL phage(s)Location(s) of primer(s)
For screening of fosmid libraryint-R2CATTTTAATTGCCAGCATCTTA558intφSa29581547-1525
int-F2ATGTTTTCGAGTTTTTGAGTTAGint989-1011
PVL-FATGTCTGGACATGATCCAA970lukS-PV45386-45404
PVL-RAACTATCTCTGCCATATGGTlukF-PV46356-46337
For long-range PCR to amplify entire structure of φSa2958
    From chromosome to integrasephiMW2-DN1GCAGAAAAAGATGCGATTGAA(2.5 kb)Chromosome of JCSC2958φSa2958Upstream of φ2958PVL
intRAGGATATCGAAAAAGATGAATCint1655-1634
    From integrase to DNA polymeraseintcTTTGTAGTGTCTTTGTATCCG9,214int1376-1396
MW1425-RTTGTTGCCATTTTTCAAGATCpol10589-10569
    From DNA polymerase to ORF JP030MW1425-FCTAAAGTAGATAATGAGCCTT8,060pol10237-10257
2958-1405R1TCCCTTTTCTTGCTTCATTTCJP03018296-18276
    From virulence-associated protein E to portal proteinCF35ACGAAGACGATTTTATCAAGG6,097por17509-17529
2958-portalR1CACTATATCTTCAGAGACATAvirE23605-23585
    From terminase large subunit to tail length tape measure proteinCF47AAAGTTATCTAATTCGATGGC10,480terL22990-23010
CF67GGGCTCTTGAATACATATCTmtp33469-33450
    From tail length tape measure protein to ORF JP0522958-1392-F10ATACTGAAAAGTGGTGGAATG8,741mtp32807-32827
phi-M-TR1GACTTCCTAAGTCGAAATAGJP05241547-41528
    From ORF JP052 to lukF-PV genephi-M-T1TGGATTAACTAAATCTAGTCG4,877JP05241480-41500
PVL-RAACTATCTCTGCCATATGGTlukF-PV46356-46337
    From ORF JP058 to chromosomeLukS-RRTGGTCAACTATATCGTGGTTTT(2 kb)JP05844574-44595
phiMW-UPTCGCCACGTTTAGCAATTTTATChromosome of JCSC2958Downstream of φSa2958
For classifying phages
    PCR-1 (for identifying φ108PVL and φPVL)portal-1FACACGTGATAAAACAGGAGAA569porφ108PVL21069-21089
portal-1RTCTAAATTAGCATCCGTGATACpor21637-21616
tail-1RATAATTGGGATAGCAACGCAA489mtp31237-31257
tail-1FCTTGATTAGACTCAACCAAACTmtp31725-31704
    PCR-2 (for identifying φ2958PVL, φSLT, and φSa2mw)portal-2FGATGGCTAGTTTGCCCTTGA656porφSa295823005-23024
portal-2RCTGAGGGCAATTGAAAAACGpor23660-23641
tail-2FCATAGCGCTAATGTCGCAAA468mtp30040-30059
tail-2RAGCCTCCATTGTTTGTTTGGmtp30507-30488
    PCR-3 (for identifying the gene lineage between genes of φ108PVL and φPVL, and lukS-PV)lukSR1ACGAAGTAGCAATAGGAGTGA10,497lukS-PVφ108PVL42326-42306
teil-ico-FAGATTTAGAAGAGGAGGCACGAmtp31830-31851
    PCR-4 (for identifying the gene lineage between genes of φSa2958, φSa2mw, and φSLT, and lukS-PV)lukSR1ACGAAGTAGCAATAGGAGTGA9,483lukS-PVφSa295844861-44841
For identifying each PVL phage
    PCR-5 (for identifying φPVL and φ108PVL)intF2ATGTTTTCGAGTTTTTGAGTTAG4,340intφ108PVL, φPVL393-415, 24310-24332
108-aRTCAAATCCGTAATCACTCATTCTantφ108PVL4732-4710
PVL-aRTTCACTAACTAAACCTATCATTGT1,411JP030φPVL25720-25697
    PCR-6 (for identifying φSa2958)int-F2ATGTTTTCGAGTTTTTGAGTTAG2,238intφSa2958989-1011
2958-aRTGGTAATCAACCATTCACTTATGAJP0043226-3203
    PCR-7 (for identifying φSa2mw)int-F2ATGTTTTCGAGTTTTTGAGTTAG4,065intφSa2mw1574920-1574898
MW2-aRTAAGTTCCTGGTGTCATTCCTAATcro1570856-1570879
    PCR-8 (for identifying φSLT)int-F2ATGTTTTCGAGTTTTTGAGTTAG8,770intφSLT123-145
SLT-aRTCTTACCAAATGCAACACAACGAATssb8892-8868