TABLE 1.

Primers used in this study

PrimerSequence 5′ → 3′TargetApplication (reference)
HS458GTTTGATGTTATGGAGCAGCAACG5′-CS attI1 endAmplify class 1 cassette arrays (18)
HS459GCAAAAAGGCAGCAATTATGAGCC3′-CSAmplify class 1 cassette arrays (18)
HS915CGTGCCGTGATCGAAATCCAGintI1PCR screen for presence of intI
HS916TTCGTGCCTTCATCCGTTTCCintI1PCR screen for presence of intI
HS501CACGGATATGCGACAAAAAGGTintI2PCR screen for presence of intI2
HS502GTAGCAAACGAGTGACGAAATGintI2PCR screen for presence of intI2
HS503GCCTCCGGCAGCGACTTTCAGintI3PCR screen for presence of intI3
HS504ACGGATCTGCCAAACCTGACTintI3PCR screen for presence of intI3
HS549ACTAAGCTTGCCCCTTCCGCsul1PCR screen for presence of sulI
HS550CTAGGCATGATCTAACCCTCGsul1PCR screen for presence of sulI
HS817CCTCCAATTGCCGTTCCTn5036-like tnpR geneaPCR screen for Tn5036 at IRi
HS818TCCTGGCGGATTCACTACC5′-CS adjacent IRiPCR screen for IRi insertion point
HS819GGGCCAGGTCTTGAGTATCGorf513PCR screen for presence of ISCR1
HS820GCTTCGGCCATCACACCorf513PCR screen for presence of ISCR1
HS825TGTTTTCGGAATCGTAGTCGCTn402-like tniA genePCR screen tniA and IRt insertion point
HS826CTGACCGGCTTGTTCGTTCTn21 merE genePCR screen for Tn21 at IRt
HS841GAAGGGTTACGCCAGTACCAGIS26PCR screen for IS26 adjacent to IRi
HS842ATGCTCAATACTCGTGTGCACCTn402-like tniA genePCR screen for presence of tniA gene
HS845CCAAACCTAGAAACGCcmlA1Targeted PCR screen for 6-cassette array identified in strain 8157
HS853GTGCAAGGTATCCTCCTGAGGTn5051 res regionPCR screen for presence of Tn5051 res region beyond IRi
HS856CATTCGCCGCTCAATGTTAACblaCTX-M-2 genePCR screen for presence of blaCTX-M-2
HS857GAAGGTCTCATCACCCAACGblaCTX-M-2 genePCR screen for presence of blaCTX-M-2
HS911GCGCGGAATACGTCGAACTn5036-like merE genePCR screen for presence of Tn5036 at IRt
  • a Also for tnpR in Tn21 (see text).