TABLE 2.

Details of loci and oligonucletide primers used in the present study

LocusGene productPrimerSequences (5′→3′)Amplicon size (bp)Usage
gltACitrate synthaseaCitrato F1AATTTACAGTGGCACATTAGGTCCC722Amplification/sequencing
Citrato R12GCAGAGATACCAGCAGAGATACACGAmplification/sequencing
gyrBDNA gyrase subunit BbAPRU FTGTAAAACGACGGCCAGTGCNGGRTCYTTYTCYTGRCA909Amplification
M13 [−21]TGTAAAACGACGGCCAGTSequencing
UP1E RCAGGAAACAGCTATGACCAYGSNGGNGGNAARTTYRAAmplification
M13 FCAGGAAACAGCTATGACCSequencing
gdhBGlucose dehydrogenase BaGDHB 1FGCTACTTTTATGCAACAGAGCC775Amplification
GDH SEC FACCACATGCTTTGTTATGSequencing
GDHB 775RGTTGAGTTGGCGTATGTTGTGCAmplification
GDH SEC RGTTGGCGTATGTTGTGCSequencing
recAHomologous recombination factorcRA1CCTGAATCTTCYGGTAAAAC425Amplification/sequencing
RA2GTTTCTGGGCTGCCAAACATTACAmplification/sequencing
cpn6060-kDa chaperoninaCPN 3F2ACTGTACTTGCTCAAGC479Amplification/sequencing
CPN R2TTCAGCGATGATAAGAAGTGGAmplification/sequencing
gpiGlucose-6-phosphate isomeraseaGPI F1AATACCGTGGTGCTACGGG508Amplification/sequencing
GPI R1AACTTGATTTTCAGGAGCAmplification/sequencing
rpoDRNA polymerase sigma factor rpoD (Sigma-70)b70F RPODACGACTGACCCGGTACGCATGTAYATGMGNGARATCGCNACNCT492Amplification
70FSACGACTGACCCGGTACGCATGTASequencing
70R RPODATAGAAATAACCAGACGTAAGTTNGCYTCNACCATYTGYTTYTTAmplification
70RSATAGAAATAACCAGACGTAAGTTSequencing
  • a Primers for citrate synthase (accession no. M33037), glucose dehydrogenase B (gdhB; accession no. X15871), 60-kDa chaperonin (cpn60; accession no. AY123669), and glucose-6-phosphate isomerase (gpi; accession no. X89900) were constructed by using available Acinetobacter sequences from conserved regions of each gene.

  • b Primers for DNA gyrase subunit B (gyrB) and RNA polymerase sigma factor rpoD (Sigma-70) (rpoB) were selected and used as described previously (41).

  • c Homologous recombination factor (recA) primers were selected and used as described previously (33).