TABLE 1.

Primers for PCR and sequencing of MBL genes

TargetUsePrimer namePrimer sequence (5′ to 3′)PositionaProduct length (bp)Reference
IMP-1AmplificationIMP1LCTACCGCAGCAGAGTCTTTG47-6658735
IMP2RAACCAGTTTTGCCTTACCAT633-614
SequencingIMP1-SQ-FACCGCAGCAGAGTCTTTGCC49-6858737
IMP1-SQ-RACAACCAGTTTTGCCTTACC635-616
IMP-2AmplificationIMP2LGTGTATGCTTCCTTTGTAGC23-4217433
IMP2RCAATCAGATAGGCGTCAGTGT196-176
SequencingIMP2-SQ-FGTTTTATGTGTATGCTTCC16-3467837
IMP2-SQ-RAGCCTGTTCCCATGTAC693-677
VIMAmplificationVIMBATGGTGTTTGGTCGCATATC152-17151032
VIMFTGGGCCATTCAGCCAGATC661-643
SequencingVIM2-SQ-FATGTTCAAACTTTTGAGTAAG1-2180137
VIM2-SQ-RCTACTCAACGACTGAGCG801-784
  • a Position number 1 for every MBL gene corresponds to the first base of the start codon.