TABLE 1.

Primers and probes used in this study

Primer or probe5′ SequenceaTemp (°C)Size(s) (bp)Reference
23S_FTGGGCACTGTCTCAACGA55633, 634b29
23S_RGGATAGGGACCGAACTGTCTC
23S_TQFACCGAACTGTCTCACGACGTT6072This study
23S_TQRCCCAAGGGTTGGGCTGTT
VIC-LIZ-TQ-SVIC-CCCAGCTCGCGTGC-NFQ-MGBThis study
FAM-LIZ-TQ-RFAM-AACCCAGCTAGCGTGC-NFQ-MGBThis study
23S_1RcGGACGCTCTAGCCAGCTGAGC551,964This study
23S_2RcGGCCTCTCGGACAACTCTCC551,272This study
23S_3RcCCCTTCTTCAAGCTTATC551,286This study
23S_4RcGTCAATCACTCAACTATGC551,756This study
ddl-EFM1GCAAGGCTTCTTAGAGA
ddl-EFM2CATCGTGTAAGCTAACTTC549414
ddl-EFC1ATCAAGTACAGTTAGTCTT
ddl-EFC2ACGATTCAAAGCTAACTG549414
  • a NFQ, nonfluorescent quencher; VIC and FAM, 5′-linked fluorescence labels (Applied Biosystems); MGB, minor groove binder.

  • b The first size applies to E. faecalis; the second applies to E. faecium.

  • c The forward primer is 23S_F.