TABLE 1.

Oligonucleotide primers and probes used in the conventional RT-PCR and TaqMan RT-PCR

AssaySerotypeIdentificationSequence (5′-3′)Size (bp)GeneNo. of strainsc
Conventional RT-PCR with cross-reactive primersDus (forward)TCAATATGCTGAAACGCGCGAGAAACCG511C-PrM.
Duc (reverse)TTGCACCAACAGTCAATGTCTTCAGGTTC
Conventional RT-PCR with type-specific primers1D1s (forward)GGACTGCGTATGGAGTTTTG490E-NS1
D1c (reverse)ATGGGTTGTGGCCTAATCAT
2D2S (forward)GTTCCTCTGCAAACACTCCA230E
D2c (reverse)GTGTTATTTTGATTTCCTTG
3D3s (forward)GTGCTTACACAGCCCTATTT320E-NS1
D3c (reverse)TCCATTCTCCCAAGCGCCTG
4D4s (forward)CCATTATGGCTGTGTTGTTT398NS2a-NS2b
D4c (reverse)CTTCATCCTGCTTCACTTCT
TaqMan RT-PCR with type- specific primers and probes1D1MGBEn469s (forward)GAACATGGRACAAYTGCAACYAT67E76d
D1MGBEn493pa (probe)ACACCTCAAGCTCC
D1MGBEn536r (reverse)CCGTAGTCDGTCAGCTGTATTTCA
2D2MGBEn493s (forward)ACACCACAGAGTTCCATCACAGA68E203e
D2MGBEn545pa (probe)CGATGGARTGCTCTC
D2MGBEn568r (reverse)CATCTCATTGAAGTCNAGGCC
3D3MGBEn1s (forward)ATGAGATGYGTGGGAGTRGGAAAC70E59f
D3MGBEn27pa (probe)AGATTTTGTGGAAGGYCT
D3MGBEn71r (reverse)CACCACDTCAACCCACGTAGCT
4D4TEn711s (forward)GGTGACRTTYAARGTHCCTCAT75E30g
D4TEn734pb (probe)CCAAGAGACAGGATGTGACAGTGCTRGGATC
D4TEn786c (reverse)WGARTGCATRGCTCCYTCCTG