TABLE 1.

List of PCR primers and hydrolysis probes

Target genePrimerSequencea (5′-3′)Reference or sourcePCR amplification
B. pseudomalleiB. malleiB. thailandensisOther species
orf11 PM122ATCGCCAAATGCCGGGTTTC 12 +
orf11RCAAATGGCCATCGTGATGTTCThis study
orf11proFAM-TCGGCGAACGCGATTTGATCGTTC-TAMRAThis study
orf13 orf13fCACCGGCAGTGATGAGCCACThis study++
orf13rATGCTCCGGCCTGACAAACGThis study
orf13proFAM-ACGCCCGTCGAAGCCCGAATC-TAMRAThis study
BpSCU2 SCU2FCTCGAGCTCGTGAAGATGATThis study+++
SCU2RACGCGTGCGATCTTGTAATCThis study
SCU2proFAM-ATGCCACGCACGCGAGCACGA-TAMRAThis study
  • a FAM, 6-carboxyfluorescein; TAMRA, 6-carboxytetramethylrhodamine.