TABLE 1.

List and characteristics of oligonucleotides used in the triplex qPCR assay

Gene and primer or probe nameaSequence (5′→3′)Length5′ dyebGenBank accession no. (reference)
mecA X52593 (44)
    F mecACATTGATCGCAACGTTCAATTT22
    R mecATGGTCTTTCTGCATTCCTGGA21
    P mecATGGAAGTTAGATTGGGATCATAGCGTCAT29JOE
femA-SA X17688 (3)
    F femA-SATGCCTTTACAGATAGCATGCCA22
    R femA-SAAGTAAGTAAGCAAGCTGCAATGACC25
    P femA-SATCATTTCACGCAAACTGTTGGCCACTATG29FAM
femA-SE U23713 (2)
    F femA-SECAACTCGATGCAAATCAGCAA21
    R femA-SEGAACCGCATAGCTCCCTGC19
    P femA-SETACTACGCTGGTGGAACTTCAAATCGTTATCG32TET
  • a femA-SA, S. aureus femA; femA-SE, S. epidermidis femA.

  • b All probes are quenched by TAMRA bound to the 3′ end.