TABLE 2.

Oligonucleotide primers for Campylobacter MLSTa

GeneForward primerReverse primerAmplicon size (bp)
NameSequenceCoordinatesNameSequenceCoordinates
aspAasp-A1FAAAGCTGCAGCTATGGC160-176asp-A2RTTCCAGTGTTCATTGCCTC1279-12971,137
asp-A3FATGAGGTTTATTATGGAGTGC50-70asp-A2RTTCCAGTGTTCATTGCCTC1279-1297
asp-A9F∗AGTACTAATGATGCTTATCC418-437asp-A10R∗ATTTCATCAATTTGTTCTTTGC1337-1358
asp-S3F∗CCAACTGCAAGATGCTGTACC561-581asp-S6R∗TCAATTTGCGGTAATACCATC1165-1184
glnAgln-A1F∗TAGGAACTTGGCATCATATTACC92-114gln-A2R∗TTGGACGAGCTTCTACTGGC1377-13961,304
gln-S1FGCTCAATTCATGGATGGC173-190gln-S4RGCATACCATTGCCATTATCTCCG801-823
gln-S2hFcGAAGAAACATTTCAAACTGG136-155gln-S3hFcCTGGCATTCCATTTGATGG152-170
gltAglt-A1F∗GGCCTTGACTTCTACAGCTACTTG138-161glt-A2R∗CCAAATAAAGTTGTCTTGGACGG1227-12491,111
glt-S1F∗GTGGCTATCCTATAGAGTGGC212-232glt-S6RCCAAAGCGCACCAATACCTG767-786
glt-S2hFcTTAATGCACCGTGGCTATCC202-221
glyAgly-A1F∗GAGTTAGAGCGTCAATGTGAAGG49-71gly-A2R∗AAACCTCTGGCAGTAAGGGC1081-11001,051
gly-A2hFcGGTCTTGAAATGATAGCGAG70-89gly-A2hRcGGAGTTCCAAGTCTTAATCC1060-1079
gly-S3F∗AGTTAATACAGGTGTTTATGCGG297-307gly-S4R∗AGGTGATTATCCGTTCCATCGC911-932
pgmpgm-A1FTTGGAACTGATGGAGTTCG11-29pgm-A2RAAGAGCTTAATATCTCTGGCTTCTAG1258-12831,272
pgm-A3FTCAGGGCTTACTTCTATAGG181-200pgm-A4RAACTTAATATCTCTGGCTTC1261-1280
pgm-A7F∗TACTAATAATATCTTAGTAGG114-134pgm-A8R∗CACAACATTTTTCATTTCTTTTTC1285-1308
pgm-S3FGCTTATAAGGTAGCACCTACTG559-580pgm-S2R∗TCCAGAATAGCGAAATAAGG1214-1233
tkttkt-A5FTTTAAGTGCTGATATGGTGC45-64tkt-A4RCATAGCGTGTTCTCTGATACC1162-11821,851
tkt-A1FTACAAGAACAGGCAAATACTCTAAG17-41tkt-A2RGAAACGCTAAATCCAAAGCG1849-1868
tkt-S1FTGCACCTTTGGGCTTAGC90-107tkt-S4R∗ACTTCTTCACCCAAAGGTGCG771-791
uncAunc-A4RAAAGCTGATGAGATCAGTTC10-29unc-A3FCTCATTAATGGCTTTAGCTAG1465-14851,475
unc-A7F∗ATGGACTTAAGAATATTATGGC125-146unc-A8RATAAATTCCATCTTCAAATTCC1362-1383
unc-S3FAAAGTACAGTGGCACAAGTGG605-625unc-S4R∗TGCCTCATCTAAATCACTAGC1195-1215
unc-S3aFdAAAGCACAGTGGCTCAAGTTG605-625unc-S3cFeGCACAGTGGCTCAAGTTGT608-626
  • a An A in the primer name indicates that it was used for amplification, an S in the primer name indicates that it was used for sequencing. An asterisk denotes that this primer was described before in the paper of Dingle et al. (6).