TABLE 1.

Oligonucleotides used in this study

OligonucleotideSequence (5′-3′)Gene amplified (serogroup)Amplicon length (bp)Source or reference
98-28GCAATAGGTGTATATATTCTTCC orf-2 (A)400 14
98-29CGTAATAGTTTCGTATGCCTTCTT orf-2 (A)400 14
98-19GGATCATTTCAGTGTTTTCCACCA synB (B)450 14
98-20GCATGCTGGAGGAATAAGCATTAA synB (B)450 14
98-17TCAAATGAGTTTGCGAATAGAAGGT synE (C)250 14
98-18CAATCACGATTTGCCCAATTGAC synE (C)250 14
98-32CAGAAAGTGAGGGATTTCCATA synG (W135)120 14
98-33CACAACCATTTTCATTATAGTTACTGT synG (W135)120 14
98-36ACGATATCCCTATCCTTGCCTA synF (Y)75This study
98-35CTGAAGCGTTTTCATTATAATTGCTAA synF (Y)75 14
XFAATGCAAATTCAATTGGTTG ctrA (X)190This study
XRCTTGGGCCTTATACAAAGAC ctrA (X)190This study