TABLE 2.

Primer and adapter oligonucleotide sequences

Primer or adapter oligonucelotideSequence (5′ to 3′)a
Mating type primers
    MFαUTTCACTGCCATCTTCACCACC
    MFαLTCTAGGCGATGACACAAAGGG
    STE20aSFUTCCGATTGCTGCGATTTGCC
    STE20aSFLGCGCCTGCACCATAATTCACC
EcoRI adapters
    EA1CTCGTAGACTGCGTACC
    EA2CATCTGACGCATGGTTAA
Msel adapters
    MA1GACGATGAGTCCTGAG
    MA2TACTCAGGACTCAT
Preamplification primers
    EcoRI-CGACTGCGTACCAATTCC
    EcoRI-GGACTGCGTACCAATTCG
    EcoRI-TGACTGCGTACCAATTCT
    Msel-CGATGAGTCCTGAGTAAC
    Msel-GGATGAGTCCTGAGTAAG
    Msel-TGATGAGTCCTGAGTAAT
Selective primers
    EcoRI-CA6 FAM-GACTGCGTACCAATTCCA
    EcoRI-GT6 FAM-GACTGCGTACCAATTCGT
    EcoRI-TG6 FAM-GACTGCGTACCAATTCTG
    Msel-CAGATGAGTCCTGAGTAACA
    Msel-GAGATGAGTCCTGAGTAAGA
    Msel-GTGATGAGTCCTGAGTAAGT
    Msel-TGGATGAGTCCTGAGTAATG
  • a Sequences are 5′ to 3′, except for those of EA2 and MA2, which are 3′ to 5′.