TABLE 1.

Primers used in this study

LocusPrimerPositionLength (bp)Sequence (5′-3′)Reference
pag 671925-1944747CAGAATCAAGTTCCCAGGGG19
682652-2671747TCGGATAAGCTGCCACAAGG19
232006-2027151CTACAGGGGATTTATCTATTCC19
242135-2156151ATTGTTACATGATTATCAGCGG19
cya 651255-1274929CAGCATGCGTTTTCTTTAGC19
662164-2183929CCCTTAGTTGAATCCGGTTT19
251459-1478546GGTTTAGTACCAGAACATGC19
261990-2004546CGGCTTCAAGACCCC19
lef 31238-1258385CTTTTGCATATTATATCGAGC19
41599-1622385GAATCACGAATATCAATTTGTAGC19
59949-970993GGATATGAACCCGTACTTGTAA19
601921-1941993TAAATCCGCACCTAGGGTTGC19
capC 571603-1622264ACTCGTTTTTAATCAGCCCG19
581847-1866264GGTAACCCTTGTCTTTGAAT19
capBCA 171230-1249873GAAATAGTTATTGCGATTGG19
202083-2102873GGTGCTACTGCTTCTGTACG19
Ba813R1227-249152TTAATTCACTTGCAACTGATGGG18
R298-120152AACGATAGCTCCTACATTTGGAG18