TABLE 1.

Primers used for amplification and sequencing

GenePrimerSequenceaAmplicon length (bp)bPositioncAccession no.d
Amplification
    ACT-1NHAmpCFATTCGTATGCTGGATCTCGCCACC396383-406AF411149
NHAmpCRCATGACCCAGTTCGCCATATCCTG778-755
Amplification and sequencing
    FOX-5FOXUP1FCACCACGAGAATAACC1,184683-698X77455
FOXD1RGCCTTGAACTCGACCG1866-1851
Sequencing
    ACT-1PCACT-1FCTTGAACTGCTATTACGGNAe3-20U58495
PCACT-1iATGCCATTGCTCGCGGT317-333
PCACT-1iiTATGAGCAGGCCATAACG598-615
PCACT-1RGCAATGTTTACTACAGCG1183-1166
    FOX-5PCFOX5FBCGCCTTGAGCATCGGCTGGNA129-111AY007369
PCFOX5RBCGCCTATGTGGCGTTCGTG1029-1047
  • a All primer sequences are written in the 5′-to-3′ direction.

  • b Expected size of the amplification product.

  • c Nucleotide position of the primer in the sequence.

  • d GenBank accession number of a sequence containing the corresponding primer sequence.

  • e NA, not applicable.