TABLE 1.

Forward and reverse sequences of primersc

Gene (function)Primer sequence (5′-3′)aAnnealing temp (°C)Amplicon size (bp)b
adk (adenylate kinase)ATTCTGCTTGGCGCTCCGGG (F)52583
CCGTCAACTTTCGCGTATTT (R)
fumC (fumarate hydratase)TCACAGGTCGCCAGCGCTTC (F)52806
GTACGCAGCGAAAAAGATTC (R)
icd (isocitrate/isopropylmalate dehydrogenase)ATGGAAAGTAAAGTAGTTGTTCCGGCACA (F)52878
GGACGCAGCAGGATCTGTT (R)
purA (adenylosuccinate dehydrogenase)CGCGCTGATGAAAGAGATGA (F)54816
CATACGGTAAGCCACGCAGA (R)
gyrB (DNA gyrase)TCGGCGACACGGATGACGGC (F)58911
ATCAGGCCTTCACGCGCATC (R)
recA (ATP/GTP binding motif)CGCATTCGCTTTACCCTGACC (F)58780
TCGTCGAAATCTACGGACCGGA (R)
mdh (malate dehydrogenase)ATGAAAGTCGCAGTCCTCGGCGCTGCTGGCGG (F)58932
TTAACGAACTCCTGCCCCAGAGCGATATCTTTCTT (R)