TABLE 1.

Molecular beacons and primers used in this study

Primer/probeaTargetSequence (5′-3′)bSize of amplicon(bp)5′ fluorescent dyec3′ quencherc
MB-PCR panel I
    mecA-FmecAGCAATACAATCGCACATACATT148
    mecA-RCCTGTTTGAGGGTGGATAGC
    mecA-MBcgcga GATGGCAAAGATATTCAACTAACTA tcgcgFAMBHQ-1
    ccrB2-FType 2 ccrCTCATGTTACARATACTTGCG107
    ccrB2-RCCTTGATAATAGCCTTCTTGG
    ccrB2-MBcgcgat TCTCGACAATGTTATTACGTTCG atcgcgHEXDABCYL
    mecI-FClass A mecCGTTATAAGTGTACGAATGGTTTTTG126
    mecI-RTCATCTGCAGAATGGGAAGTT
    mecI-MBcgcga ACTCCAGTCCTTTTGCATTTGTA tcgcgCAL Fluor Red 610BHQ-2
    IS1272J-FClass B mecGAAGCTTTGGGCGATAAAGA98
    IS1272J-RGCACTGTCTCGTTTAGACCAATC
    IS1272J-MBcgcga AGCCATTGCACATGAGTTAA tcgcgQuasar 670BHQ-2
MB-PCR panel II
    ccrC-FType 5 ccrTCCAGTCTATAAAGGSTATGTCAG124
    ccrC-RACTTATAATGGCTTCATGCTTACC
    ccrC-MBcgcgat GCTGTTCAGCGAAGAAGTGGTAA atcgcgFAMDABCYL
    ccrB1-FType 1 and 3 ccrACCACAAACACACTTAAAGATG150
    ccrB1-RCAATTTCAAGTATTTGGTCCATAAC
    ccrB3-FAACACAACGAACACATTGAAAG130
    ccrB3-RCGTATTTCTCAATCACATCAGC
    ccrB1/3-MBdcgcgat AAAGGCTCAAAGGTATGTTCTGC atcgcgHEXDABCYL
    ccrB4-FType 4 ccrCGAAGTATAGACACTGGAGCGATA134
    ccrB4-RGCGACTCTCTTGGCGTTTA
    ccrB4-MBcgcga GACGAAAAGGACTCAATGAGG tcgcgCAL Fluor Red 610BHQ-2
    mecC2-FClass C2 mecTCAGTTCATTGCTCACGATATG174
    mecC2-RGCCAACGGCTACAGTGATAA
    mecC2-MBcgcga ACCAAAAGGAGTCTTCTGTATG tcgcgQuasar 670BHQ-2
SCCmec IVa subtyping
    IVa-J1-FIVa-J1 regionCAGGATATTTTTCAAACTCCTTCA131
    IVa-J1-RTGGAGGACCAAGGATATTCG
    IVa-J1-MBcgcga CATTAGTGTCCATGTCCGTT tcgcgCAL Fluor Red 610BHQ-2
spa (S. aureus)e
    spa-FProtein ACATTACTTATATCTGGTGGCG98
    spa-RGTTAGGCATATTTAAGACTTG
    spa-MBcgcga TTGTTGAGCTTCATCGTGTTG tcgcgQuasar 670BHQ-2
  • a F, forward primer; R, reverse primer; MB, molecular beacon.

  • b Complementary arm sequences (hairpins) in each molecular beacon are shown in lowercase.

  • c FAM, fluorescein; HEX, hexachlorofluorescein; BHQ, Black Hole Quencher; DABCYL, 4-(4′-dimethylaminophenylazo)benzoic acid.

  • d The mismatch site between ccrB1 and ccrB3 is underlined; a 150-bp amplicon is generated with the ccrB1 primers, versus a 130-bp amplicon with the ccrB3 primers.

  • e S. aureus-specific primer-probe set (70) used to distinguish S. aureus from CoNS and to confirm MB-PCR results for MSSA.