TABLE 2.

Primers used in this study

PrimerSequence (5′→3′)
spa-1FaATATGGATCCGATGACTTTACAAATACATACAGGGGGTb
spa-1RcATATCCCGGGTGAGGCGTTTCAGAAGTTGTTTAGAd
spa-2FaGATGACTTTACAAATACATACAGGGGGT
spa-2ReAAAATGCACTGAGCAACAAAAGATG
spa-3FfATAGCGTGATTTTGCGGTT
spa-3RgCTAAATATAAATAATGTTGTCACTTGGA
rt-spa FTATCTGGTGGCGTAACA
rt-spa RTAGGCATATTTAACACTTGAT
gyrA FCAACATTACGTCCTTTAGGC
gyrA RGCTACATCAAGCCCTACAAC
spa-probe FCAATTCGTAAACTAGGTGTAGG
spa-probe RTTGGAGCTTGAGAGTCATTA
  • a Located 34 to 7 bp upstream of the S region.

  • b The SmaI restriction site is underlined.

  • c Located 180 to 156 bp downstream of the stop codon of spa.

  • d The BamHI restriction site is underlined.

  • e Located 139 to 115 bp downstream of the stop codon.

  • f Located 178 to 160 bp upstream of the S region.

  • g Located 332 to 305 bp downstream of the stop codon.