TABLE 2.

Primers used in this study

TargetProduct length (bp)Product melting temp (°C)Primer
Mean ± 95% confidence intervalRangeNameSequence
fbl (S. lugdunensis)6372.66 ± 0.0971.7-73.2 fbl forwardGAAGCAACAACGCAGAACAA
fbl reverseTGCTTGTGCCTCGCTATTTA
ftsZ (S. aureus)21776.25 ± 0.0675.3-77.2 ftsZ forwardTTACTGGTGGCGAGTCATTG
ftsZ reverseTTTACGCTTGTTCCGAATCC
mecA 9473.18 ± 0.0772.4-73.8 mecA forwardCTGCTATCCACCCTCAAACAG
mecA reverseTCTTCGTTACTCATGCCATACA
Staphylococcal 16S rRNA17080.21 ± 0.0579.0-81.1Staph16S forwardCAGCTCGTGTCGTGAGATGT
Staph16S reverseTAGCACGTGTGTAGCCCAAA