TABLE 6.

Primers used for long-range PCR and DNA sequencing

ProcedurePrimerNucleotide sequence (5′-3′)Region amplifiedSizeReference
Long-range PCR for BK20781Left-FATTCGGTACACGCAATGAAARight chromosome junction to ccrB48.5 kbThis study
B4-R1CTTTATGATTCAATGCGTTC
A4-F1TATTGTGTTGCTATCGCTTG ccrA4 to Tn5549.5 kbThis study
Tn554-RCTAAAAACCAATTCCGACAG
Tn554-FCGGAAAAATACCAAATCAAGTn554 to mecA11.5 kbThis study
MA-RAGTTTTTCGAGTCCCTTTTT
MA-FAACAAATGGATCAAAATTGG mecA to left chromosome junction7.3 kbThis study
CR2AAACGACATGAAAATCACCAT 30
Long-range PCR for BK793ccrC-2ACTTATAATGGCTTCATGCTTACC ccrC to orfX10 kbThis study
Xsau325GGATCAAACGGCCTGCACA 28
Partial ccrC amplification andccrC-F2CGAAATGGTRTTAAGTTGGAAAWithin ccrC587 bpThis study
    sequencing for BK793 and HAR36ccrC-R1TGGCTTCATGYTTWCCTTTG
Long-range PCR for AR43/3330.1B4-F4CGGCAAAGGAACAAACCTAC ccrB4 to SCCmec J19.5 kbThis study
J IVc-RATAGATTCTACTGCAAGTCC 52
Partial ccrAB4 sequencing forA4-F1TATTGTGTTGCTATCGCTTG ccrA4 to ccrB42.7 kbThis study
    AR43/3330.1, BK2391, and BK2539B4-R3GTGCTAGGGAGCACTTCGTC