TABLE 2.

Primers used to detect genes in five separate regions in the ETT2 locusa

RegionGenes in ETT2Primer sequence (5′ to 3′)
AeprH-eprKTAGAATGGCCCTATACTTCC
GTTTGGCAGTATTCATTGCC
BepaO-epaSTTATCTTCTGAAGAGAGCTG
GTAAATCGAAACACTCTACG
LepaO-eprKACGTTAGATTGCGCATTTCG
AGTTAATGTTCGGTCTGAGG
CeivC-eivJCCTTCATTTTCTTGCTCCTC
TCTTGCGATATGGAGCATGC
DeivF-eivAGAAGATACTTCGAGGTCTCG
AGGACAGAAGTTAACCCTAC
  • a PCR conditions were 25 cycles of 98°C for 1 min, 60°C for 10 min, and 72°C 150 min.