TABLE 3.

Primers used to detect pathogenic STEC genesa

Target geneSequence (5′ to 3′)Cycle conditions (30 cycles)Product size (bp)
DenaturationAnnealingExtension
stx, commonGAGCGAAATAATTTATATGTG94°C, 1 min58°C, 1 min72°C, 1 min518
TGATGATGGCAATTCAGTAT
stx1GCAGTTCGTGGCAAGAGCG94°C, 1 min62°C, 1 min72°C, 1 min522
GCGTCGCCAGCGCACTTG
stx2AATTTATATGTGGCAGGGTTC94°C, 1 min52°C, 1 min72°C, 1 min806
CTTCACTGTAAATGTGTCATC
stx2 B subunitGTTATACTGAATTGCCATCATC94°C, 1 min52°C, 1 min72°C, 1 min435
GTCATTATTAATCTGGAC
eae, commonCCCGAATTCGGCACAAGCATAAGC94°C, 30 s52°C, 1 min72°C, 2 min881
CCCGGATCCGTCTCGCCAGTATTCG
eaeCCCGAATTCGGCACAAGCATAAGC94°C, 45 s48°C, 1 min72°C, 2 min 30 s2,807
CCCGAATTCTTATTTTACACAAGTGGC
eaeCCCGAATTCGGCACAAGCATAAGC94°C, 45 s48°C, 1 min72°C, 2 min 30 s2,287
CCCGTGATACCAGTACCAATTACGGTC
eaeCCCGAATTCGGCACAAGCATAAGC94°C, 1 min52°C, 1 min72°C, 1 min2,792
CCCGAATTCTTATTCTACACAAACCGC
eaeCCCGAATTCGGCACAAGCATAAGC94°C, 45 min48°C, 1 min72°C, 2 min 30 s2,608
AGCTCACTCGTAGATGACGGCAAGCG
hlyAGGTGCAGCAGAAAAAGTTGTAG94°C, 1 s54°C, 1 min72°C, 1 min 30 s1,551
TCTCGCCTGATAGTGTTTGGTA
  • a Each primer set was described in other reports (1, 12, 13, 21, 25). stx, gene for Shiga toxin; stx1, gene for Shiga toxin type 1; stx2, gene for Shiga toxin type2; eae, gene for intimin; hlyA, gene for a plasmid-coded enterohemolysin.