TABLE 1.

Descriptions of the primers used in this study

Method and primerOligonucleotide sequence (5′-3′)Size of ampliconsGene/region ampifiedReference or source
Multiplex PCR
    pap1GACGGCTGTACTGCAGGGTGTGGCG328 bp papC 3
    pap2ATATCCTTTCTGCAGGGATGCAATA
    sfa1CTCCGGAGAACTGGGTGCATCTTAC410 bp sfaD/sfaE 3
    sfa2CGGAGGAGTAATTACAAACCTGGCA
    cnf1aAAGATGGAGTTTCCTATGCAGGAG498 bpcnf1This work
    cnf2aCATTCAGAGTCCTGCCCTCATTATT
    usp1modTTCTGGGGAACTGACATTCACGG657 bp usp This work
    usp2modCCTCAGGGACATAGGGGGAA
    fimGH1GCAATGTTGGCGTTCGCAAGTGC1,001 bp fimG/fimH This work
    fimGH2CGTAAATATTCCACACAAACTGG
    hly1modAACAACGATAAGCACTGTTCTGGCT1,177 bphly1 3, modified
    hly2modACCATATAAGCGGTCATTCCCATCA
Triplex PCR
    TspE4C1GAGTAATGTCGGGGCATTCA152 bpTSPE4.C2 5
    TspE4C2CGCGCCAACAAAGTATTACG
    YjA1TGAAGTGTCAGGAGACGCTG211 bp yjaA
    YjA2ATGGAGAATGCGTTCCTCAAC
    ChuA1GACGAACCAACGGTCAGGAT279 bp chuA
    ChuA2TGCCGCCAGTACCAAAGACA
PCR
    UidA-FCATTACGGCAAAGTGTGGGTCAAT658 bp uidA EcMLST database
    UidA-RCCATCAGCACGTTATCGAATCCTT
CGG-PCR
    CGG(N)6(CGG)40.1-2.5 kbpRegions between loci complementary to (CGG)nThis work
ERIC-PCR
    ERIC1RATGTAAGCTCCTGGGGATTCAC0.1-2.5 kbpRegions between ERIC 40
    ERIC2AAGTAAGTGACTGGGGTGAGCG