TABLE 2.

Oligonucleotides and probes used in this study

VirusLocationNameSequence (5′-3′)Reference or source
Influenza A virus (M gene)17-37aFluA-M52CCTTCTAACCGAGGTCGAAACG 5
238-261aFluA-M253RAGGGCATTTTGGACAAAKCGTCTA 5
331-351aswH1M351RTCCTTGGCCCCATGGAAYGTTThis study
151-177aInfA ForwardfGACCRATCCTGTCACCTCTGAC 2
211-234aInfA ReversefAGGGCATTYTGGACAAAKCGTCTA 2
238-261aInfA probefTGCAGTCCTCGCTCACTGGGCACG 2
11-31aFWISMGGCGGATCCATGAGCCTTCTAACCGAGGTCThis study
972-992aRWISMGGCCTCGAGTTACTCCAACTCTATGCTGACThis study
Influenza A virus (HA gene)107-127bSwH1FCAGACACTGTAGACACAGTACThis study
602-623bSwH1RCTAGTAGATGGATGGTGAATGCThis study
920-942bSW H1 ForwardfGTGCTATAAACACCAGCCTYCCA 2
1010-1035bSW H1 ReversefCGGGATATTCCTTAATCCTGTRGC 2
946-975bSW H1 probefCAGAATATACATCCRGTCACAATTGGARAA 2
63-86bH1-1GATGCAGACACAATATGTATAGG 25
635-658bH1-2CICTACAGAGACATAAGCATTT 25
248-269bHA1-230-FGGATCTTAGGAAACCCAGAATGThis study
756-775bHA1 757-RGTTCCAGCAGAGTCCACTAGThis study
100-120cH3ha100fCATGCAGTACCAAACGGAACGThis study
394-415cH3ha415rCATTGTTAAACTCCAGTGTGCCThis study
144-165cH3-1TCAGATTGAAGTGACTAATGCT 25
1100-1120cH3-2AATTTTGATGCCTGAAACCGT 25
Influenza B virus (M gene)90-109dFluB-B/MPTTACACTGTTGGTTCGGTGG 13
594-613dFluB/MP-1RGGCAGTTTTTGGACGTCTTC 13
RSV (F gene)1111-1133eHRSVMPFO2AACAGTTTAACATTACCAAGTGA 14
1468-1490eHRSVMPRW2TCATTGACTTGAGATATTGATGC 14
  • a Oligonucleotides are numbered as aligned to GenBank accession number FJ998210 for sequences encoding the matrix protein.

  • b Oligonucleotides are numbered as aligned to GenBank accession number FJ998207 for hemagglutinin H1 of influenza A/Canada-NS/RV1535/2009 (H1N1) virus.

  • c Oligonucleotides are numbered as aligned to GenBank accession number EU399751 for hemagglutinin H3 of influenza A/Ontario/1252/2007 (H3N2) virus.

  • d Oligonucleotides are numbered as aligned to GenBank accession number CY018486 for the M gene of influenza B/Canada/1688/2000 virus.

  • e Oligonucleotides are numbered as aligned to GenBank accession number AF013254 for the fusion gene of human RSV.

  • f Primers and probes sequences as well as the protocol for the real-time RT-PCR were provided by the CDC (2). The TaqMan probe was labeled at the 5′ end with the reporter molecule 6-carboxyfluorescein (FAM) and at the 3′ end with the quencher BlackHole Quencher 1 (BHQ1) (BioSearch Technologies, Inc., Novato, CA).