TABLE 1.

Primers used to amplify and sequence the IGS region

PrimerSequence (5′ to 3′)Corresponding position in IGS sequence of strain CBS 7966
Amplification
    26S-FATCCTTTGCAGACGACTTGA3′ end of 26S rDNA
    P1RACTGGCAGGATCAACCAGAT5′ end of 18S rDNA
Sequencing
    Forward
        26S-FATCCTTTGCAGACGACTTGA3′ end of 26S rDNA
        gb-F2CCGATCTGCGAAGTTAAGCA483-502
        gb-F3GATCATAGCCTCATCATGTGCA997-1018
        gb-F4GAATACGTGACAATTTGTGTGG1380-1401
        gb-F5GTCGCACTGGAGAAAGATGT1765-1784
    Reverse
        P1RACTGGCAGGATCAACCAGAT5′ end of 18S rDNA
        gb-R2ACATCTTTCTCCAGTGCGAC1784-1765
        gb-R3CCACACAAATTGTCACGTATTC1401-1380
        gb-R4TGCACATGATGAGGCTATGATC1018-997
        gb-R5TGCTTAACTTCGCAGATCGG502-483