TABLE 1.

Primers for respiratory virus RT-PCR assay panel

Virus (reference)PrimerLength (nt)GeneLocationPolaritySequence (5′→3′)Amplicon size (bp)
HRSV (24)RSVAB-F1-FAM23F1124-1146+AACAGTTTAACATTACCAAGTGA380
RSVAB-R1231481-1503TCATTGACTTGAGATATTGATGC
HPIV1 (5)HPIV1-F1-FAM22HN780-801+CCGGTAATTTCTCATACCTATG317
HPIV1-R1211076-1096CCTTGGAGCGGAGTTGTTAAG
HPIV2 (5)HPIV2-F1-FAM22HN845-866+CCATTTACCTAAGTGATGGAAT204
HPIV2-R1221027-1048GCCCTGTTGTATTTGGAAGAGA
HPIV3 (5)HPIV3-F1-FAM22HN884-905+ACTCCCAAAGTTGATGAAAGAT103
HPIV3-R122965-986TAAATCTTGTTGTTGAGATTGA
Influenza A virus (3)FLUA-F1-FAM20NS1465-484+CTAAGGGCTTTCACCGAAGA192
FLUA-R120637-656CCCATTCTCATTACTGCTTC
Influenza B virus (3)FLUB-F1-FAM21NS1746-765+ATGGCCATCGGATCCTCAAC241
FLUB-R120967-986TGTCAGCTATTATGGAGCTG
RNA control (27)BACTIN-F2-FAM18Human β-actin−8-26+CCTCGCCTTTGCCGATCC626
BACTIN-R223596-618GGATCTTCATGAGGTAGTCAGTC